Rmu_co8277925.1_g000001

receptor-like protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8277925.1
OG0003002
Physical Location & Seq
Reverse (-)
1 .. 674
674 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8277925.1_g000001.1.cds

Sequence Viewer

Length: 439 bp
atgatgcttttagtcctgatagttcttattcgtaagaaaagcagagagctagtggattttgaagatatagataagacatcaaaatcatttcccccacctcgtcctttaaggaaatttcatgaaggtcctccatctatgtttcaaaaattcagctacaaggagataaagaaggcgacagacaatttcaatactaccattggacaagggggatttggaactgtgtacaaagctcactttagtgatggtttagtagcagcagtgaagcggatgaacaaagtttccgagcagggggagcatgagttctgcagagagatagtgcttcttgccaggttgcatcatcggcatcttgtttctcttaggggcttctgcattgagaaacatgagaggtttctgatgtatgagtacatggcaaatggtagcctgaaggatcatcttcatt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pkinase Pkinase_Tyr

Protein Analysis

146

Amino Acids

17.02

Weight (kDa)

9.52

Isoelectric Point (pI)

29.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 265
AclWI GGATC 1 cut(s) 435
AcsI RAATTY 2 cut(s) 113, 146
AfaI GTAC 2 cut(s) 224, 404
AfiI CCNNNNNNNGG 1 cut(s) 288
AgsI TTSAA 3 cut(s) 62, 143, 187
AjnI CCWGG 1 cut(s) 326
AleI CACNNNNGTG 1 cut(s) 237
AloI GAACNNNNNNTCC 4 cut(s) 263, 284, 295, 316
AluBI AGCT 3 cut(s) 49, 153, 230
AluI AGCT 3 cut(s) 49, 153, 230
AlwI GGATC 1 cut(s) 435
ApeKI GCWGC 1 cut(s) 254
ApoI RAATTY 2 cut(s) 113, 146
AspS9I GGNCC 1 cut(s) 125
AvaII GGWCC 1 cut(s) 125
BbvI GCAGC 1 cut(s) 266
BccI CCATC 2 cut(s) 139, 236
BciT130I CCWGG 1 cut(s) 328
BfaI CTAG 1 cut(s) 50
BfmI CTRYAG 1 cut(s) 304
BisI GCNGC 1 cut(s) 255
BlsI GCNGC 1 cut(s) 256
Bme1390I CCNGG 1 cut(s) 328
Bme18I GGWCC 1 cut(s) 125
BmgT120I GGNCC 1 cut(s) 125
BmrFI CCNGG 1 cut(s) 328
BmsI GCATC 2 cut(s) 343, 352
BsaXI ACNNNNNCTCC 2 cut(s) 284, 314
Bsc4I CCNNNNNNNGG 1 cut(s) 288
BseBI CCWGG 1 cut(s) 328
BseGI GGATG 1 cut(s) 273
BseLI CCNNNNNNNGG 1 cut(s) 288
BseXI GCAGC 1 cut(s) 266
BslI CCNNNNNNNGG 1 cut(s) 288
Bsp1407I TGTACA 1 cut(s) 222
Bsp143I GATC 1 cut(s) 427
BspACI CCGC 1 cut(s) 265
BspHI TCATGA 1 cut(s) 118
BspMAI CTGCAG 1 cut(s) 308
BspPI GGATC 1 cut(s) 435
BsrGI TGTACA 1 cut(s) 222
BssMI GATC 1 cut(s) 427
Bst2UI CCWGG 1 cut(s) 328
Bst4CI ACNGT 1 cut(s) 220
BstAUI TGTACA 1 cut(s) 222
BstDEI CTNAG 1 cut(s) 356
BstF5I GGATG 1 cut(s) 273
BstKTI GATC 1 cut(s) 430
BstMBI GATC 1 cut(s) 427
BstMWI GCNNNNNNNGC 2 cut(s) 292, 340
BstNI CCWGG 1 cut(s) 328
BstSCI CCNGG 1 cut(s) 326
BstSFI CTRYAG 1 cut(s) 304
BstV1I GCAGC 1 cut(s) 266
BtsCI GGATG 1 cut(s) 273
BtsI GCAGTG 1 cut(s) 264
BtsIMutI CAGTG 1 cut(s) 264
CciI TCATGA 1 cut(s) 118
Cfr13I GGNCC 1 cut(s) 125
Csp6I GTAC 2 cut(s) 223, 403
CviAII CATG 4 cut(s) 119, 296, 380, 406
CviJI RGCY 5 cut(s) 49, 153, 230, 363, 420
CviKI_1 RGCY 5 cut(s) 49, 153, 230, 363, 420
CviQI GTAC 2 cut(s) 223, 403
DdeI CTNAG 1 cut(s) 356
DpnI GATC 1 cut(s) 429
DpnII GATC 1 cut(s) 427
Eco47I GGWCC 1 cut(s) 125
EcoO109I RGGNCCY 1 cut(s) 125
EcoRII CCWGG 1 cut(s) 326
FaeI CATG 4 cut(s) 122, 299, 383, 409
FaiI YATR 7 cut(s) 68, 120, 137, 297, 381, 399, 407
FatI CATG 4 cut(s) 118, 295, 379, 405
Fnu4HI GCNGC 1 cut(s) 255
FokI GGATG 1 cut(s) 280
Fsp4HI GCNGC 1 cut(s) 255
FspBI CTAG 1 cut(s) 50
GluI GCNGC 1 cut(s) 255
Hin1II CATG 4 cut(s) 122, 299, 383, 409
Hpy166II GTNNAC 1 cut(s) 223
Hpy188I TCNGA 2 cut(s) 283, 393
Hpy188III TCNNGA 2 cut(s) 16, 119
Hpy8I GTNNAC 1 cut(s) 223
HpyAV CCTTC 3 cut(s) 116, 163, 418
HpyCH4III ACNGT 1 cut(s) 220
HpyCH4V TGCA 3 cut(s) 306, 334, 369
HpyF10VI GCNNNNNNNGC 2 cut(s) 292, 340
HpyF3I CTNAG 1 cut(s) 356
Hsp92II CATG 4 cut(s) 122, 299, 383, 409
Kzo9I GATC 1 cut(s) 427
LmnI GCTCC 1 cut(s) 292
LpnPI CCDG 5 cut(s) 29, 272, 313, 340, 434
Lsp1109I GCAGC 1 cut(s) 266
LweI GCATC 2 cut(s) 343, 352
MaeI CTAG 1 cut(s) 50
MalI GATC 1 cut(s) 429
MboI GATC 1 cut(s) 427
MboII GAAGA 2 cut(s) 74, 425
MluCI AATT 3 cut(s) 113, 146, 181
MnlI CCTC 3 cut(s) 108, 138, 378
MseI TTAA 1 cut(s) 107
MslI CAYNNNNRTG 1 cut(s) 237
MspR9I CCNGG 1 cut(s) 328
MvaI CCWGG 1 cut(s) 328
MwoI GCNNNNNNNGC 2 cut(s) 292, 340
NdeII GATC 1 cut(s) 427
NlaIII CATG 4 cut(s) 122, 299, 383, 409
OliI CACNNNNGTG 1 cut(s) 237
PagI TCATGA 1 cut(s) 118
PkrI GCNGC 1 cut(s) 256
PpuMI RGGWCCY 1 cut(s) 125
Psp5II RGGWCCY 1 cut(s) 125
Psp6I CCWGG 1 cut(s) 326
PspGI CCWGG 1 cut(s) 326
PspPI GGNCC 1 cut(s) 125
PspPPI RGGWCCY 1 cut(s) 125
PstI CTGCAG 1 cut(s) 308
RsaI GTAC 2 cut(s) 224, 404
RsaNI GTAC 2 cut(s) 223, 403
RseI CAYNNNNRTG 1 cut(s) 237
SaqAI TTAA 1 cut(s) 107
SatI GCNGC 1 cut(s) 255
Sau3AI GATC 1 cut(s) 427
Sau96I GGNCC 1 cut(s) 125
ScrFI CCNGG 1 cut(s) 328
SetI ASST 7 cut(s) 51, 100, 127, 155, 232, 332, 389
SfaNI GCATC 2 cut(s) 343, 352
SfcI CTRYAG 1 cut(s) 304
SinI GGWCC 1 cut(s) 125
SmiMI CAYNNNNRTG 1 cut(s) 237
Sse9I AATT 3 cut(s) 113, 146, 181
SsiI CCGC 1 cut(s) 265
SspMI CTAG 1 cut(s) 50
StyD4I CCNGG 1 cut(s) 326
TaaI ACNGT 1 cut(s) 220
TasI AATT 3 cut(s) 113, 146, 181
TatI WGTACW 2 cut(s) 222, 402
Tru1I TTAA 1 cut(s) 107
Tru9I TTAA 1 cut(s) 107
TscAI CASTG 1 cut(s) 264
TseI GCWGC 1 cut(s) 254
TspDTI ATGAA 4 cut(s) 107, 135, 284, 425
TspRI CASTG 1 cut(s) 264
VpaK11BI GGWCC 1 cut(s) 125
XapI RAATTY 2 cut(s) 113, 146
XspI CTAG 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.