Rmu_co8329807.1_g000001

Domain of unknown function (DUF4408)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8329807.1
OG0011769
Physical Location & Seq
Reverse (-)
2 .. 692
691 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8329807.1_g000001.1.cds

Sequence Viewer

Length: 691 bp
atggcagctatgttggctttcatgctcagctggctcacacccacctccctcttcatcttcctcaacctcgccatcggcaccctcgtcatctcccaccgcttctgcaaaacacctcagcaacaaccccaacacgaccagttcggtagaccgccctcgctcctggaacgtgtcaggtcgttcgacttctcccactacaacttccaacccgatcacccggaaccccatcacgtaacggaaaacccgaccggattagtccggactccgtcactcatggagcggctcaggtccatcaacttttcccactacaacttccaacatcactacccggaacccgaacacgtaacggaatacccagcaccggacaacccgaccgaatttgtccggactccgtcactcatggagcggctcaggtccatcaacttttcccagtacgacttccaacatcaccacccggaacccgaacacgtaacggaacacccagcaccggacaacccgaccggatttgtccggactccgtcactcatggagcggctcaggtccatcaacttttcccagtacgacttccaacaacccgacccggaacccgaacacgtaacagaacacccaacaccggaaaacccgaccggaatagtccggacgccctcgctcctggcccgtctcaagtcaatggatttctcctctctctacagat
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4408 DUF761

Protein Analysis

230

Amino Acids

26.88

Weight (kDa)

6.07

Isoelectric Point (pI)

48.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011769)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G26130 AT5G56980
fragaria_vesca FvH4_1g07560
malus_domestica MD02G1080400.v1.1 MD15G1207800.v1.1
prunus_persica Prupe.7G209100_v2.0.a1
pyrus_communis pycom15g18410
rosa_laevigata RLG00000016403
rosa_multiflora Rmu_co8329807.1_g000001 Rmu_sc0004086.1_g000010 Rmu_sc0021911.1_g000006
rosa_roxburghii Rroxscaffold_2G00148090
rosa_rugosa Rorug02G0036200 Rorug02G0036300
rosa_samantha Rh2AG082500 Rh2BG083300 Rh2CG085300 Rh2DG081400
rosa_wichuraiana Rw2G006470

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 77
AccBSI CCGCTC 3 cut(s) 277, 403, 529
AccI GTMKAC 1 cut(s) 145
AccIII TCCGGA 4 cut(s) 255, 381, 507, 633
AciI CCGC 5 cut(s) 97, 149, 277, 403, 529
AcsI RAATTY 1 cut(s) 374
AcyI GRCGYC 1 cut(s) 638
AfaI GTAC 2 cut(s) 431, 557
AfiI CCNNNNNNNGG 3 cut(s) 358, 484, 610
AflIII ACRYGT 4 cut(s) 166, 337, 463, 589
AjnI CCWGG 2 cut(s) 159, 648
AluBI AGCT 2 cut(s) 8, 30
AluI AGCT 2 cut(s) 8, 30
Alw26I GTCTC 1 cut(s) 662
Aor13HI TCCGGA 4 cut(s) 255, 381, 507, 633
AoxI GGCC 1 cut(s) 651
ApeKI GCWGC 1 cut(s) 5
ApoI RAATTY 1 cut(s) 374
AspS9I GGNCC 4 cut(s) 285, 411, 537, 652
AsuC2I CCSGG 4 cut(s) 215, 326, 452, 578
AsuHPI GGTGA 2 cut(s) 203, 437
AvaII GGWCC 3 cut(s) 285, 411, 537
BanI GGYRCC 1 cut(s) 77
BbvCI CCTCAGC 1 cut(s) 114
BbvI GCAGC 1 cut(s) 17
BccI CCATC 5 cut(s) 80, 231, 296, 422, 548
BciT130I CCWGG 2 cut(s) 161, 650
BcnI CCSGG 4 cut(s) 215, 326, 452, 578
BcoDI GTCTC 1 cut(s) 662
BfmI CTRYAG 1 cut(s) 685
BisI GCNGC 4 cut(s) 6, 278, 404, 530
BlpI GCTNAGC 1 cut(s) 26
BlsI GCNGC 4 cut(s) 7, 279, 405, 531
Bme1390I CCNGG 6 cut(s) 161, 215, 326, 452, 578, 650
Bme18I GGWCC 3 cut(s) 285, 411, 537
BmgT120I GGNCC 4 cut(s) 285, 411, 537, 652
BmiI GGNNCC 5 cut(s) 79, 219, 330, 456, 582
BmrFI CCNGG 6 cut(s) 161, 215, 326, 452, 578, 650
BmrI ACTGGG 2 cut(s) 421, 547
BmuI ACTGGG 2 cut(s) 421, 547
Bpu10I CCTNAGC 4 cut(s) 114, 281, 407, 533
Bpu1102I GCTNAGC 1 cut(s) 26
BpuEI CTTGAG 1 cut(s) 644
BpuMI CCSGG 4 cut(s) 215, 326, 452, 578
BsaAI YACGTR 4 cut(s) 229, 340, 466, 592
BsaHI GRCGYC 1 cut(s) 638
Bsc4I CCNNNNNNNGG 3 cut(s) 358, 484, 610
Bse1I ACTGG 3 cut(s) 136, 427, 553
BseAI TCCGGA 4 cut(s) 255, 381, 507, 633
BseBI CCWGG 2 cut(s) 161, 650
BseLI CCNNNNNNNGG 3 cut(s) 358, 484, 610
BseMII CTCAG 5 cut(s) 40, 128, 295, 421, 547
BseNI ACTGG 3 cut(s) 136, 427, 553
BseRI GAGGAG 1 cut(s) 667
BseXI GCAGC 1 cut(s) 17
BseYI CCCAGC 2 cut(s) 352, 478
Bsh1285I CGRYCG 4 cut(s) 246, 372, 498, 624
BshFI GGCC 1 cut(s) 653
BshNI GGYRCC 1 cut(s) 77
BsiEI CGRYCG 4 cut(s) 246, 372, 498, 624
BslI CCNNNNNNNGG 3 cut(s) 358, 484, 610
BsmAI GTCTC 1 cut(s) 662
BsmBI CGTCTC 1 cut(s) 662
BsnI GGCC 1 cut(s) 653
Bsp13I TCCGGA 4 cut(s) 255, 381, 507, 633
Bsp143I GATC 1 cut(s) 208
Bsp1720I GCTNAGC 1 cut(s) 26
BspACI CCGC 5 cut(s) 97, 149, 277, 403, 529
BspANI GGCC 1 cut(s) 653
BspCNI CTCAG 5 cut(s) 39, 127, 294, 420, 546
BspEI TCCGGA 4 cut(s) 255, 381, 507, 633
BspLI GGNNCC 5 cut(s) 79, 219, 330, 456, 582
BspT107I GGYRCC 1 cut(s) 77
BsrBI CCGCTC 3 cut(s) 277, 403, 529
BsrI ACTGG 3 cut(s) 136, 427, 553
BssMI GATC 1 cut(s) 208
BssNI GRCGYC 1 cut(s) 638
Bst2UI CCWGG 2 cut(s) 161, 650
Bst6I CTCTTC 1 cut(s) 56
BstACI GRCGYC 1 cut(s) 638
BstBAI YACGTR 4 cut(s) 229, 340, 466, 592
BstC8I GCNNGC 1 cut(s) 32
BstDEI CTNAG 5 cut(s) 26, 114, 281, 407, 533
BstKTI GATC 1 cut(s) 211
BstMAI GTCTC 1 cut(s) 662
BstMBI GATC 1 cut(s) 208
BstMCI CGRYCG 4 cut(s) 246, 372, 498, 624
BstMWI GCNNNNNNNGC 2 cut(s) 14, 31
BstNI CCWGG 2 cut(s) 161, 650
BstSCI CCNGG 6 cut(s) 159, 213, 324, 450, 576, 648
BstSFI CTRYAG 1 cut(s) 685
BstV1I GCAGC 1 cut(s) 17
BsuRI GGCC 1 cut(s) 653
Cac8I GCNNGC 1 cut(s) 32
Cfr13I GGNCC 4 cut(s) 285, 411, 537, 652
CseI GACGC 1 cut(s) 646
Csp6I GTAC 2 cut(s) 430, 556
CviAII CATG 4 cut(s) 22, 271, 397, 523
CviJI RGCY 8 cut(s) 8, 17, 30, 34, 280, 406, 532, 653
CviKI_1 RGCY 8 cut(s) 8, 17, 30, 34, 280, 406, 532, 653
CviQI GTAC 2 cut(s) 430, 556
DdeI CTNAG 5 cut(s) 26, 114, 281, 407, 533
DpnI GATC 1 cut(s) 210
DpnII GATC 1 cut(s) 208
Eam1104I CTCTTC 1 cut(s) 56
EarI CTCTTC 1 cut(s) 56
Eco47I GGWCC 3 cut(s) 285, 411, 537
EcoRII CCWGG 2 cut(s) 159, 648
Esp3I CGTCTC 1 cut(s) 662
FaeI CATG 4 cut(s) 25, 274, 400, 526
FaiI YATR 5 cut(s) 11, 23, 272, 398, 524
FatI CATG 4 cut(s) 21, 270, 396, 522
FblI GTMKAC 1 cut(s) 145
Fnu4HI GCNGC 4 cut(s) 6, 278, 404, 530
Fsp4HI GCNGC 4 cut(s) 6, 278, 404, 530
GluI GCNGC 4 cut(s) 6, 278, 404, 530
GsaI CCCAGC 2 cut(s) 356, 482
HaeIII GGCC 1 cut(s) 653
HgaI GACGC 1 cut(s) 646
Hin1I GRCGYC 1 cut(s) 638
Hin1II CATG 4 cut(s) 25, 274, 400, 526
HinfI GANTC 3 cut(s) 259, 385, 511
HphI GGTGA 2 cut(s) 203, 437
Hpy166II GTNNAC 1 cut(s) 146
Hpy188III TCNNGA 4 cut(s) 256, 382, 508, 634
Hpy8I GTNNAC 1 cut(s) 146
HpyCH4IV ACGT 5 cut(s) 166, 228, 339, 465, 591
HpyCH4V TGCA 1 cut(s) 105
HpyF10VI GCNNNNNNNGC 2 cut(s) 14, 31
HpyF3I CTNAG 5 cut(s) 26, 114, 281, 407, 533
HpySE526I ACGT 5 cut(s) 166, 228, 339, 465, 591
Hsp92I GRCGYC 1 cut(s) 638
Hsp92II CATG 4 cut(s) 25, 274, 400, 526
Kpn2I TCCGGA 4 cut(s) 255, 381, 507, 633
Kzo9I GATC 1 cut(s) 208
LmnI GCTCC 5 cut(s) 162, 274, 400, 526, 651
Lsp1109I GCAGC 1 cut(s) 17
MaeII ACGT 5 cut(s) 166, 228, 339, 465, 591
MaeIII GTNAC 7 cut(s) 229, 264, 340, 390, 466, 516, 592
MalI GATC 1 cut(s) 210
MbiI CCGCTC 3 cut(s) 277, 403, 529
MboI GATC 1 cut(s) 208
MboII GAAGA 2 cut(s) 43, 49
MluCI AATT 1 cut(s) 374
MlyI GAGTC 3 cut(s) 253, 379, 505
MmeI TCCRAC 4 cut(s) 226, 337, 463, 589
MnlI CCTC 9 cut(s) 55, 59, 71, 77, 92, 123, 163, 652, 688
MroI TCCGGA 4 cut(s) 255, 381, 507, 633
MspA1I CMGCKG 1 cut(s) 30
MspR9I CCNGG 6 cut(s) 161, 215, 326, 452, 578, 650
MvaI CCWGG 2 cut(s) 161, 650
MwoI GCNNNNNNNGC 2 cut(s) 14, 31
NciI CCSGG 4 cut(s) 215, 326, 452, 578
NdeII GATC 1 cut(s) 208
NlaIII CATG 4 cut(s) 25, 274, 400, 526
NlaIV GGNNCC 5 cut(s) 79, 219, 330, 456, 582
NmuCI GTSAC 3 cut(s) 264, 390, 516
PcsI WCGNNNNNNNCGW 2 cut(s) 81, 239
PflFI GACNNNGTC 3 cut(s) 262, 388, 514
PfoI TCCNGGA 1 cut(s) 159
PkrI GCNGC 4 cut(s) 7, 279, 405, 531
PleI GAGTC 3 cut(s) 253, 379, 505
PpsI GAGTC 3 cut(s) 253, 379, 505
Ppu21I YACGTR 4 cut(s) 229, 340, 466, 592
Psp6I CCWGG 2 cut(s) 159, 648
PspFI CCCAGC 2 cut(s) 352, 478
PspGI CCWGG 2 cut(s) 159, 648
PspN4I GGNNCC 5 cut(s) 79, 219, 330, 456, 582
PspPI GGNCC 4 cut(s) 285, 411, 537, 652
PsyI GACNNNGTC 3 cut(s) 262, 388, 514
PvuII CAGCTG 1 cut(s) 30
RsaI GTAC 2 cut(s) 431, 557
RsaNI GTAC 2 cut(s) 430, 556
SatI GCNGC 4 cut(s) 6, 278, 404, 530
Sau3AI GATC 1 cut(s) 208
Sau96I GGNCC 4 cut(s) 285, 411, 537, 652
SchI GAGTC 3 cut(s) 253, 379, 505
ScrFI CCNGG 6 cut(s) 161, 215, 326, 452, 578, 650
SfcI CTRYAG 1 cut(s) 685
SinI GGWCC 3 cut(s) 285, 411, 537
SmlI CTYRAG 1 cut(s) 659
SmoI CTYRAG 1 cut(s) 659
Sse9I AATT 1 cut(s) 374
SsiI CCGC 5 cut(s) 97, 149, 277, 403, 529
StyD4I CCNGG 6 cut(s) 159, 213, 324, 450, 576, 648
TaiI ACGT 5 cut(s) 169, 231, 342, 468, 594
TaqI TCGA 1 cut(s) 180
TaqII GACCGA 1 cut(s) 386
TasI AATT 1 cut(s) 374
TauI GCSGC 3 cut(s) 280, 406, 532
TseFI GTSAC 3 cut(s) 264, 390, 516
TseI GCWGC 1 cut(s) 5
Tsp45I GTSAC 3 cut(s) 264, 390, 516
TspDTI ATGAA 2 cut(s) 10, 43
TspGWI ACGGA 6 cut(s) 248, 252, 359, 378, 485, 504
Tth111I GACNNNGTC 3 cut(s) 262, 388, 514
VpaK11BI GGWCC 3 cut(s) 285, 411, 537
XapI RAATTY 1 cut(s) 374
XmiI GTMKAC 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.