Rmu_co8384533.1_g000001

Domain of unknown function (DUF3067)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8384533.1
Physical Location & Seq
Forward (+)
1 .. 1076
1076 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8384533.1_g000001.1.cds

Sequence Viewer

Length: 531 bp
gatatgacgagcattatttcaagccaccattgtaattggtcatttgggattcaagagaacgctaacacaggattcaacaaagttctgcttcctggatatacttcacattttccttcaagaggattggttttttccaatggtaactgtcacattcgttgtcaaactgatcggagatgtaggcctattttctccagtacggtagatgacataaatccagatgactctgaagatgaaaaggatgcgaaggaaaactccaaagctgaagctggaggggggaataatgaaatggtcagagagaatcttgaaagacttgttggtacagatgactccagctttagtgggatagacctggcaactcttattaggaacaagtatgggaggtcctatgatgttcaactgataaagaaggagttcctggggagaaacctcttggctatgaatgtgatgtggaagtacagggagcaggtatggaaattcttactcaacaatttaaagtttcttgttggaataagtagcatatcattatcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

176

Amino Acids

19.92

Weight (kDa)

6.48

Isoelectric Point (pI)

29.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 454
AcsI RAATTY 1 cut(s) 473
AcuI CTGAAG 2 cut(s) 246, 282
AfaI GTAC 3 cut(s) 196, 319, 455
AfiI CCNNNNNNNGG 1 cut(s) 119
AgsI TTSAA 6 cut(s) 21, 53, 76, 117, 305, 395
AjnI CCWGG 3 cut(s) 91, 348, 414
AjuI GAANNNNNNNTTGG 2 cut(s) 297, 329
AluBI AGCT 3 cut(s) 260, 266, 333
AluI AGCT 3 cut(s) 260, 266, 333
AoxI GGCC 1 cut(s) 179
ApoI RAATTY 1 cut(s) 473
Asp700I GAANNNNTTC 1 cut(s) 410
AspS9I GGNCC 1 cut(s) 381
AvaII GGWCC 1 cut(s) 381
BciT130I CCWGG 3 cut(s) 93, 350, 416
BfuAI ACCTGC 1 cut(s) 454
Bme1390I CCNGG 3 cut(s) 93, 350, 416
Bme18I GGWCC 1 cut(s) 381
BmgT120I GGNCC 1 cut(s) 381
BmrFI CCNGG 3 cut(s) 93, 350, 416
BmsI GCATC 1 cut(s) 229
BpmI CTGGAG 3 cut(s) 175, 288, 313
BsaJI CCNNGG 1 cut(s) 415
Bsc4I CCNNNNNNNGG 1 cut(s) 119
Bse1I ACTGG 1 cut(s) 192
BseBI CCWGG 3 cut(s) 93, 350, 416
BseDI CCNNGG 1 cut(s) 415
BseGI GGATG 1 cut(s) 244
BseLI CCNNNNNNNGG 1 cut(s) 119
BseNI ACTGG 1 cut(s) 192
BshFI GGCC 1 cut(s) 181
BslI CCNNNNNNNGG 1 cut(s) 119
BsnI GGCC 1 cut(s) 181
Bsp143I GATC 1 cut(s) 166
BspANI GGCC 1 cut(s) 181
BspMI ACCTGC 1 cut(s) 454
BsrI ACTGG 1 cut(s) 192
BssECI CCNNGG 1 cut(s) 415
BssMI GATC 1 cut(s) 166
Bst2UI CCWGG 3 cut(s) 93, 350, 416
Bst4CI ACNGT 2 cut(s) 146, 199
BstENI CCTNNNNNAGG 1 cut(s) 117
BstF5I GGATG 1 cut(s) 244
BstKTI GATC 1 cut(s) 169
BstMBI GATC 1 cut(s) 166
BstNI CCWGG 3 cut(s) 93, 350, 416
BstSCI CCNGG 3 cut(s) 91, 348, 414
BsuRI GGCC 1 cut(s) 181
BtsCI GGATG 1 cut(s) 244
BveI ACCTGC 1 cut(s) 454
Cfr13I GGNCC 1 cut(s) 381
Csp6I GTAC 3 cut(s) 195, 318, 454
CviJI RGCY 6 cut(s) 24, 181, 260, 266, 333, 434
CviKI_1 RGCY 6 cut(s) 24, 181, 260, 266, 333, 434
CviQI GTAC 3 cut(s) 195, 318, 454
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
DraI TTTAAA 1 cut(s) 492
Eco147I AGGCCT 1 cut(s) 181
Eco47I GGWCC 1 cut(s) 381
Eco57I CTGAAG 2 cut(s) 246, 282
EcoNI CCTNNNNNAGG 1 cut(s) 117
EcoO109I RGGNCCY 1 cut(s) 381
EcoRII CCWGG 3 cut(s) 91, 348, 414
FaiI YATR 9 cut(s) 5, 99, 209, 375, 387, 437, 469, 518, 529
FalI AAGNNNNNCTT 2 cut(s) 72, 104
FokI GGATG 1 cut(s) 251
GsuI CTGGAG 3 cut(s) 175, 288, 313
HaeIII GGCC 1 cut(s) 181
HinfI GANTC 5 cut(s) 49, 72, 221, 298, 326
Hpy188I TCNGA 3 cut(s) 171, 226, 293
Hpy188III TCNNGA 4 cut(s) 53, 117, 215, 302
HpyAV CCTTC 3 cut(s) 123, 238, 400
HpyCH4III ACNGT 2 cut(s) 146, 199
Kzo9I GATC 1 cut(s) 166
LmnI GCTCC 1 cut(s) 460
LweI GCATC 1 cut(s) 229
MaeIII GTNAC 2 cut(s) 140, 146
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MboII GAAGA 1 cut(s) 239
MluCI AATT 3 cut(s) 34, 473, 487
MlyI GAGTC 2 cut(s) 215, 320
MmeI TCCRAC 1 cut(s) 484
MnlI CCTC 4 cut(s) 113, 263, 372, 437
MroXI GAANNNNTTC 1 cut(s) 410
MseI TTAA 1 cut(s) 491
MspR9I CCNGG 3 cut(s) 93, 350, 416
MvaI CCWGG 3 cut(s) 93, 350, 416
NdeII GATC 1 cut(s) 166
NmuCI GTSAC 1 cut(s) 146
PceI AGGCCT 1 cut(s) 181
PdmI GAANNNNTTC 1 cut(s) 410
PfeI GAWTC 3 cut(s) 49, 72, 298
PfoI TCCNGGA 1 cut(s) 91
PleI GAGTC 2 cut(s) 215, 320
PpsI GAGTC 2 cut(s) 215, 320
PpuMI RGGWCCY 1 cut(s) 381
Psp5II RGGWCCY 1 cut(s) 381
Psp6I CCWGG 3 cut(s) 91, 348, 414
PspGI CCWGG 3 cut(s) 91, 348, 414
PspPI GGNCC 1 cut(s) 381
PspPPI RGGWCCY 1 cut(s) 381
RsaI GTAC 3 cut(s) 196, 319, 455
RsaNI GTAC 3 cut(s) 195, 318, 454
SaqAI TTAA 1 cut(s) 491
Sau3AI GATC 1 cut(s) 166
Sau96I GGNCC 1 cut(s) 381
SchI GAGTC 2 cut(s) 215, 320
ScrFI CCNGG 3 cut(s) 93, 350, 416
SetI ASST 7 cut(s) 262, 268, 335, 351, 383, 429, 468
SfaNI GCATC 1 cut(s) 229
SinI GGWCC 1 cut(s) 381
Sse9I AATT 3 cut(s) 34, 473, 487
SseBI AGGCCT 1 cut(s) 181
StuI AGGCCT 1 cut(s) 181
StyD4I CCNGG 3 cut(s) 91, 348, 414
TaaI ACNGT 2 cut(s) 146, 199
TasI AATT 3 cut(s) 34, 473, 487
TatI WGTACW 1 cut(s) 453
TfiI GAWTC 3 cut(s) 49, 72, 298
Tru1I TTAA 1 cut(s) 491
Tru9I TTAA 1 cut(s) 491
TseFI GTSAC 1 cut(s) 146
Tsp45I GTSAC 1 cut(s) 146
TspDTI ATGAA 3 cut(s) 246, 297, 452
VpaK11BI GGWCC 1 cut(s) 381
XagI CCTNNNNNAGG 1 cut(s) 117
XapI RAATTY 1 cut(s) 473
XmnI GAANNNNTTC 1 cut(s) 410
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.