Rroxscaffold_5G00386810

Domain of unknown function (DUF3067)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0007081
Physical Location & Seq
Forward (+)
65591203 .. 65594708
3506 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00386810.1

Sequence Viewer

Length: 753 bp
ATGCACCACGAGTCTACTCTACCATATCCCAAACAAGCATCAAACCCAGAAACTATATCTGCTTCCGTTGCTTGGCCTCACCAACAGGATATGACGAGCATTATTTCAAGTCACCATTGTAATTGGTCATTTGGGATTCAAGAGAACGCTAACACAGGATTCAACAAAGTTCTGCTTCCTGGATATACTTCACATTTTCCTTCAAGAGGATTGGTTTTTTCCAATGGTAACTATCACATTCGTTGTCAAACTGATCGGAGATGTAGGCCTATTTTCTCCAGTACGGTAGATGACATAAATCCAGATGACTCTGAAGATGAAAAGGATGCGAAGGAAAATTCCAAAGCTGAAGCTGGAGGGGGGAATAATGAAATGGTCAGAGAGAATCTTGAAAGACTTGTTGGTACAGATGACTCCAGCTTTAGTGGGATAGACCTGGCAACTCTTATTAGGAACAAGTATGGGAGGTCCTATGATGTTCAACTGATAAAGAAGGAGTTCCTGGGAAGAAACCTCTTGGCTATGAATGTGATGTGGAAGTACAGGGAGCAGAGATCCTTTCCACTGACTGAAGAAGAGTATCTATTGAGGCTTGATGATGTTGCAAACAACTTGAAGTGCTGGGGAGCTGTGTCACATATCAGAAACAGCCTAGCAACGGTGAAAGAGAGGCCTCGGATAGGAAAGGCTGTTAGCATTTTTATAGATATGGACGAGTCTGGAGGCCGTGCAAATGAATGGATTTACAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF3067

Protein Analysis

250

Amino Acids

28.43

Weight (kDa)

6.08

Isoelectric Point (pI)

40.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF3067 PF11267 145 - 248 3.6e-34 Domain of unknown function (DUF3067)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 14
AclWI GGATC 1 cut(s) 549
AcsI RAATTY 1 cut(s) 337
AcuI CTGAAG 3 cut(s) 333, 369, 591
AfaI GTAC 3 cut(s) 283, 406, 542
AfiI CCNNNNNNNGG 4 cut(s) 72, 206, 658, 680
AgsI TTSAA 7 cut(s) 108, 140, 163, 204, 392, 482, 616
AjnI CCWGG 3 cut(s) 178, 435, 501
AjuI GAANNNNNNNTTGG 2 cut(s) 384, 416
AluBI AGCT 4 cut(s) 347, 353, 420, 629
AluI AGCT 4 cut(s) 347, 353, 420, 629
AlwI GGATC 1 cut(s) 549
AoxI GGCC 4 cut(s) 74, 266, 671, 724
ApoI RAATTY 1 cut(s) 337
Asp700I GAANNNNTTC 1 cut(s) 497
AspS9I GGNCC 1 cut(s) 468
AsuHPI GGTGA 3 cut(s) 71, 104, 673
AvaII GGWCC 1 cut(s) 468
BauI CACGAG 1 cut(s) 8
BceAI ACGGC 1 cut(s) 711
BciT130I CCWGG 3 cut(s) 180, 437, 503
BfaI CTAG 1 cut(s) 653
Bme1390I CCNGG 3 cut(s) 180, 437, 503
Bme18I GGWCC 1 cut(s) 468
BmgT120I GGNCC 1 cut(s) 468
BmrFI CCNGG 3 cut(s) 180, 437, 503
BmsI GCATC 2 cut(s) 47, 316
BpmI CTGGAG 4 cut(s) 262, 375, 400, 741
BsaJI CCNNGG 2 cut(s) 502, 674
Bsc4I CCNNNNNNNGG 4 cut(s) 72, 206, 658, 680
Bse1I ACTGG 1 cut(s) 279
BseBI CCWGG 3 cut(s) 180, 437, 503
BseDI CCNNGG 2 cut(s) 502, 674
BseGI GGATG 1 cut(s) 331
BseLI CCNNNNNNNGG 4 cut(s) 72, 206, 658, 680
BseNI ACTGG 1 cut(s) 279
BseYI CCCAGC 1 cut(s) 621
BshFI GGCC 4 cut(s) 76, 268, 673, 726
BslI CCNNNNNNNGG 4 cut(s) 72, 206, 658, 680
BsnI GGCC 4 cut(s) 76, 268, 673, 726
Bsp143I GATC 2 cut(s) 253, 554
BspANI GGCC 4 cut(s) 76, 268, 673, 726
BspPI GGATC 1 cut(s) 549
BsrI ACTGG 1 cut(s) 279
BssECI CCNNGG 2 cut(s) 502, 674
BssMI GATC 2 cut(s) 253, 554
BssSI CACGAG 1 cut(s) 8
Bst2BI CACGAG 1 cut(s) 8
Bst2UI CCWGG 3 cut(s) 180, 437, 503
Bst4CI ACNGT 2 cut(s) 286, 661
Bst6I CTCTTC 1 cut(s) 570
BstENI CCTNNNNNAGG 2 cut(s) 204, 678
BstF5I GGATG 1 cut(s) 331
BstKTI GATC 2 cut(s) 256, 557
BstMBI GATC 2 cut(s) 253, 554
BstMWI GCNNNNNNNGC 1 cut(s) 68
BstNI CCWGG 3 cut(s) 180, 437, 503
BstSCI CCNGG 3 cut(s) 178, 435, 501
BstX2I RGATCY 1 cut(s) 554
BstYI RGATCY 1 cut(s) 554
BsuRI GGCC 4 cut(s) 76, 268, 673, 726
BtsCI GGATG 1 cut(s) 331
BtsIMutI CAGTG 1 cut(s) 563
Cfr13I GGNCC 1 cut(s) 468
Csp6I GTAC 3 cut(s) 282, 405, 541
CviQI GTAC 3 cut(s) 282, 405, 541
DpnI GATC 2 cut(s) 255, 556
DpnII GATC 2 cut(s) 253, 554
Eam1104I CTCTTC 1 cut(s) 570
EarI CTCTTC 1 cut(s) 570
Eco147I AGGCCT 2 cut(s) 268, 673
Eco47I GGWCC 1 cut(s) 468
Eco57I CTGAAG 3 cut(s) 333, 369, 591
EcoNI CCTNNNNNAGG 2 cut(s) 204, 678
EcoO109I RGGNCCY 1 cut(s) 468
EcoRII CCWGG 3 cut(s) 178, 435, 501
FalI AAGNNNNNCTT 2 cut(s) 159, 191
FblI GTMKAC 1 cut(s) 14
FokI GGATG 1 cut(s) 338
FspBI CTAG 1 cut(s) 653
GsaI CCCAGC 1 cut(s) 625
GsuI CTGGAG 4 cut(s) 262, 375, 400, 741
HaeIII GGCC 4 cut(s) 76, 268, 673, 726
HinfI GANTC 7 cut(s) 11, 136, 159, 308, 385, 413, 716
HphI GGTGA 3 cut(s) 71, 104, 673
Hpy166II GTNNAC 1 cut(s) 15
Hpy188I TCNGA 5 cut(s) 258, 313, 380, 644, 678
Hpy188III TCNNGA 5 cut(s) 140, 204, 302, 389, 720
Hpy8I GTNNAC 1 cut(s) 15
HpyAV CCTTC 3 cut(s) 210, 325, 487
HpyCH4III ACNGT 2 cut(s) 286, 661
HpyCH4V TGCA 3 cut(s) 4, 605, 731
HpyF10VI GCNNNNNNNGC 1 cut(s) 68
Kzo9I GATC 2 cut(s) 253, 554
LmnI GCTCC 2 cut(s) 547, 626
LweI GCATC 2 cut(s) 47, 316
MaeI CTAG 1 cut(s) 653
MaeIII GTNAC 3 cut(s) 110, 227, 633
MalI GATC 2 cut(s) 255, 556
MboI GATC 2 cut(s) 253, 554
MboII GAAGA 4 cut(s) 326, 519, 584, 587
MflI RGATCY 1 cut(s) 554
MluCI AATT 2 cut(s) 121, 337
MlyI GAGTC 4 cut(s) 20, 302, 407, 725
MnlI CCTC 9 cut(s) 87, 200, 350, 459, 524, 582, 663, 684, 716
MroXI GAANNNNTTC 1 cut(s) 497
MspR9I CCNGG 3 cut(s) 180, 437, 503
MvaI CCWGG 3 cut(s) 180, 437, 503
MwoI GCNNNNNNNGC 1 cut(s) 68
NdeII GATC 2 cut(s) 253, 554
NmuCI GTSAC 2 cut(s) 110, 633
PceI AGGCCT 2 cut(s) 268, 673
PdmI GAANNNNTTC 1 cut(s) 497
PfeI GAWTC 3 cut(s) 136, 159, 385
PfoI TCCNGGA 1 cut(s) 178
PleI GAGTC 4 cut(s) 19, 302, 407, 724
PpsI GAGTC 4 cut(s) 19, 302, 407, 724
PpuMI RGGWCCY 1 cut(s) 468
Psp5II RGGWCCY 1 cut(s) 468
Psp6I CCWGG 3 cut(s) 178, 435, 501
PspFI CCCAGC 1 cut(s) 621
PspGI CCWGG 3 cut(s) 178, 435, 501
PspPI GGNCC 1 cut(s) 468
PspPPI RGGWCCY 1 cut(s) 468
PsuI RGATCY 1 cut(s) 554
RsaI GTAC 3 cut(s) 283, 406, 542
RsaNI GTAC 3 cut(s) 282, 405, 541
Sau3AI GATC 2 cut(s) 253, 554
Sau96I GGNCC 1 cut(s) 468
SchI GAGTC 4 cut(s) 20, 302, 407, 725
ScrFI CCNGG 3 cut(s) 180, 437, 503
SetI ASST 7 cut(s) 349, 355, 422, 438, 470, 516, 631
SfaNI GCATC 2 cut(s) 47, 316
SinI GGWCC 1 cut(s) 468
Sse9I AATT 2 cut(s) 121, 337
SseBI AGGCCT 2 cut(s) 268, 673
SspMI CTAG 1 cut(s) 653
StuI AGGCCT 2 cut(s) 268, 673
StyD4I CCNGG 3 cut(s) 178, 435, 501
TaaI ACNGT 2 cut(s) 286, 661
TasI AATT 2 cut(s) 121, 337
TatI WGTACW 1 cut(s) 540
TfiI GAWTC 3 cut(s) 136, 159, 385
TscAI CASTG 1 cut(s) 570
TseFI GTSAC 2 cut(s) 110, 633
Tsp45I GTSAC 2 cut(s) 110, 633
TspDTI ATGAA 4 cut(s) 333, 384, 539, 750
TspGWI ACGGA 1 cut(s) 55
TspRI CASTG 1 cut(s) 570
VpaK11BI GGWCC 1 cut(s) 468
XagI CCTNNNNNAGG 2 cut(s) 204, 678
XapI RAATTY 1 cut(s) 337
XmiI GTMKAC 1 cut(s) 14
XmnI GAANNNNTTC 1 cut(s) 497
XspI CTAG 1 cut(s) 653
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.