Rw4G036920

Domain of unknown function (DUF3067)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
OG0007081
Physical Location & Seq
Forward (+)
63708958 .. 63712000
3043 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G036920.1

Sequence Viewer

Length: 525 bp
ATGACGAGCATTATTTCAAGCCACCATTGTAATTGGTCATTTGGGATTCAAGAGAACGCTAACACAGGATTCAACAAAGTTCTGCTTCCTGGATATACTTCACATTTTCCTTCAAGAGGATTGGTTTTTTCCAATGGTAACTGTCACATTCGTTGTCAAACTGATCGGAGATGTAGGCCTATTTTCTCCAGTACGGTAGATGACATAAATCCAGATGACTCTGAAGATGAAAAGGATGCGAAGGAAAACTCCAAAGCTGAAGCTGGAGGGGGGAATAATGAAATGGTCAGAGAGAATCTTGAAAGACTTGTTGGTACAGATGACTCCAGCTTTAGTGGGATAGACCTGGCAACTCTTATTAGGAACAAGTATGGGAGGTCCTATGATGTTCAACTGATAAAGAAGGAGTTCCTGGGAAGAAACCTCTTGGCTATGAATGTGATGTGGAAGTACAGGGAGCAGAGATCCTTTCCACTTACTGAAGAAGAGTATCTATTGAGGCTGATGATGTTGCAAACAACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF3067

Protein Analysis

174

Amino Acids

19.89

Weight (kDa)

5.82

Isoelectric Point (pI)

41.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF3067 PF11267 115 - 170 1.8e-16 Domain of unknown function (DUF3067)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 459
AcuI CTGAAG 3 cut(s) 243, 279, 501
AfaI GTAC 3 cut(s) 193, 316, 452
AfiI CCNNNNNNNGG 1 cut(s) 116
AgsI TTSAA 6 cut(s) 18, 50, 73, 114, 302, 392
AjnI CCWGG 3 cut(s) 88, 345, 411
AjuI GAANNNNNNNTTGG 2 cut(s) 294, 326
AluBI AGCT 3 cut(s) 257, 263, 330
AluI AGCT 3 cut(s) 257, 263, 330
AlwI GGATC 1 cut(s) 459
AoxI GGCC 1 cut(s) 176
Asp700I GAANNNNTTC 1 cut(s) 407
AspS9I GGNCC 1 cut(s) 378
AvaII GGWCC 1 cut(s) 378
BciT130I CCWGG 3 cut(s) 90, 347, 413
Bme1390I CCNGG 3 cut(s) 90, 347, 413
Bme18I GGWCC 1 cut(s) 378
BmgT120I GGNCC 1 cut(s) 378
BmrFI CCNGG 3 cut(s) 90, 347, 413
BmsI GCATC 1 cut(s) 226
BpmI CTGGAG 3 cut(s) 172, 285, 310
BsaJI CCNNGG 1 cut(s) 412
Bsc4I CCNNNNNNNGG 1 cut(s) 116
Bse1I ACTGG 1 cut(s) 189
BseBI CCWGG 3 cut(s) 90, 347, 413
BseDI CCNNGG 1 cut(s) 412
BseGI GGATG 1 cut(s) 241
BseLI CCNNNNNNNGG 1 cut(s) 116
BseNI ACTGG 1 cut(s) 189
BshFI GGCC 1 cut(s) 178
BslI CCNNNNNNNGG 1 cut(s) 116
BsnI GGCC 1 cut(s) 178
Bsp143I GATC 2 cut(s) 163, 464
BspANI GGCC 1 cut(s) 178
BspPI GGATC 1 cut(s) 459
BsrI ACTGG 1 cut(s) 189
BssECI CCNNGG 1 cut(s) 412
BssMI GATC 2 cut(s) 163, 464
Bst2UI CCWGG 3 cut(s) 90, 347, 413
Bst4CI ACNGT 2 cut(s) 143, 196
Bst6I CTCTTC 1 cut(s) 480
BstENI CCTNNNNNAGG 1 cut(s) 114
BstF5I GGATG 1 cut(s) 241
BstKTI GATC 2 cut(s) 166, 467
BstMBI GATC 2 cut(s) 163, 464
BstNI CCWGG 3 cut(s) 90, 347, 413
BstSCI CCNGG 3 cut(s) 88, 345, 411
BstX2I RGATCY 1 cut(s) 464
BstYI RGATCY 1 cut(s) 464
BsuRI GGCC 1 cut(s) 178
BtsCI GGATG 1 cut(s) 241
Cfr13I GGNCC 1 cut(s) 378
Csp6I GTAC 3 cut(s) 192, 315, 451
CviJI RGCY 7 cut(s) 21, 178, 257, 263, 330, 431, 502
CviKI_1 RGCY 7 cut(s) 21, 178, 257, 263, 330, 431, 502
CviQI GTAC 3 cut(s) 192, 315, 451
DpnI GATC 2 cut(s) 165, 466
DpnII GATC 2 cut(s) 163, 464
Eam1104I CTCTTC 1 cut(s) 480
EarI CTCTTC 1 cut(s) 480
Eco147I AGGCCT 1 cut(s) 178
Eco47I GGWCC 1 cut(s) 378
Eco57I CTGAAG 3 cut(s) 243, 279, 501
EcoNI CCTNNNNNAGG 1 cut(s) 114
EcoO109I RGGNCCY 1 cut(s) 378
EcoRII CCWGG 3 cut(s) 88, 345, 411
FaiI YATR 5 cut(s) 96, 206, 372, 384, 434
FalI AAGNNNNNCTT 2 cut(s) 69, 101
FokI GGATG 1 cut(s) 248
GsuI CTGGAG 3 cut(s) 172, 285, 310
HaeIII GGCC 1 cut(s) 178
HinfI GANTC 5 cut(s) 46, 69, 218, 295, 323
Hpy188I TCNGA 3 cut(s) 168, 223, 290
Hpy188III TCNNGA 4 cut(s) 50, 114, 212, 299
HpyAV CCTTC 3 cut(s) 120, 235, 397
HpyCH4III ACNGT 2 cut(s) 143, 196
HpyCH4V TGCA 1 cut(s) 514
Kzo9I GATC 2 cut(s) 163, 464
LmnI GCTCC 1 cut(s) 457
LweI GCATC 1 cut(s) 226
MaeIII GTNAC 2 cut(s) 137, 143
MalI GATC 2 cut(s) 165, 466
MboI GATC 2 cut(s) 163, 464
MboII GAAGA 4 cut(s) 236, 429, 494, 497
MflI RGATCY 1 cut(s) 464
MluCI AATT 1 cut(s) 31
MlyI GAGTC 2 cut(s) 212, 317
MnlI CCTC 5 cut(s) 110, 260, 369, 434, 492
MroXI GAANNNNTTC 1 cut(s) 407
MspR9I CCNGG 3 cut(s) 90, 347, 413
MvaI CCWGG 3 cut(s) 90, 347, 413
NdeII GATC 2 cut(s) 163, 464
NmuCI GTSAC 1 cut(s) 143
PceI AGGCCT 1 cut(s) 178
PdmI GAANNNNTTC 1 cut(s) 407
PfeI GAWTC 3 cut(s) 46, 69, 295
PfoI TCCNGGA 1 cut(s) 88
PleI GAGTC 2 cut(s) 212, 317
PpsI GAGTC 2 cut(s) 212, 317
PpuMI RGGWCCY 1 cut(s) 378
Psp5II RGGWCCY 1 cut(s) 378
Psp6I CCWGG 3 cut(s) 88, 345, 411
PspGI CCWGG 3 cut(s) 88, 345, 411
PspPI GGNCC 1 cut(s) 378
PspPPI RGGWCCY 1 cut(s) 378
PsuI RGATCY 1 cut(s) 464
RsaI GTAC 3 cut(s) 193, 316, 452
RsaNI GTAC 3 cut(s) 192, 315, 451
Sau3AI GATC 2 cut(s) 163, 464
Sau96I GGNCC 1 cut(s) 378
SchI GAGTC 2 cut(s) 212, 317
ScrFI CCNGG 3 cut(s) 90, 347, 413
SetI ASST 6 cut(s) 259, 265, 332, 348, 380, 426
SfaNI GCATC 1 cut(s) 226
SinI GGWCC 1 cut(s) 378
Sse9I AATT 1 cut(s) 31
SseBI AGGCCT 1 cut(s) 178
StuI AGGCCT 1 cut(s) 178
StyD4I CCNGG 3 cut(s) 88, 345, 411
TaaI ACNGT 2 cut(s) 143, 196
TasI AATT 1 cut(s) 31
TatI WGTACW 1 cut(s) 450
TfiI GAWTC 3 cut(s) 46, 69, 295
TseFI GTSAC 1 cut(s) 143
Tsp45I GTSAC 1 cut(s) 143
TspDTI ATGAA 3 cut(s) 243, 294, 449
VpaK11BI GGWCC 1 cut(s) 378
XagI CCTNNNNNAGG 1 cut(s) 114
XmnI GAANNNNTTC 1 cut(s) 407
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.