Rmu_co8387167.1_g000001

Subunit of clathrin-associated adaptor protein complex that plays a role in protein sorting in the late-Golgi trans-Golgi network (TGN) and or endosomes. The AP complexes mediate both the recruitment of clathrin to membranes and the recognition of sorting signals within the cytosolic tails of transmembrane cargo molecules

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8387167.1
OG0006717
Physical Location & Seq
Forward (+)
1 .. 1007
1007 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8387167.1_g000001.1.cds

Sequence Viewer

Length: 440 bp
tgtctcaaggtcctccaagctcattattgcaggttgctgtgaaaaacaatcaacaacctgtctggtacttcaacgataaaatcccattgcatgtcttctttaccgaggatggcagaatggagcgtgcaaattttcttgagacttggagatcccttcctgattcaaatgagattacaaaagacttccctggaattgtggtgggtaatgttgaagcaactctggaccgcctggctgctacaaacatgttctttattgcgaagcgaaaacacgccaaccaggatgtcttctatttctctgcaaagatacctcgaggaatacccttcctaattgaactcactacagtagtaaatacccctggggtcaagtgcgcaatcaagactccaagcccagaatcagcaccccttttctttgaagctgtggagacactcctgaaggactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0005911 GO:0009506 GO:0016020 GO:0030054 GO:0044464 GO:0055044 GO:0071944
KEGG Pathways
Metabolic & Signaling
ko04142 map04142
Pfam Domains
Protein Families
Adaptin_N Alpha_adaptinC2 B2-adapt-app_C

Protein Analysis

145

Amino Acids

16.3

Weight (kDa)

6.11

Isoelectric Point (pI)

36.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 308
Acc16I TGCGCA 1 cut(s) 369
Acc36I ACCTGC 1 cut(s) 21
AciI CCGC 1 cut(s) 225
AclWI GGATC 1 cut(s) 143
AcsI RAATTY 1 cut(s) 129
AfaI GTAC 1 cut(s) 67
AflIII ACRYGT 1 cut(s) 242
AgsI TTSAA 5 cut(s) 72, 164, 211, 331, 412
AjnI CCWGG 4 cut(s) 186, 227, 275, 354
AluBI AGCT 2 cut(s) 20, 415
AluI AGCT 2 cut(s) 20, 415
Alw26I GTCTC 3 cut(s) 8, 133, 415
AlwI GGATC 1 cut(s) 143
Ama87I CYCGRG 1 cut(s) 308
ApeKI GCWGC 1 cut(s) 232
ApoI RAATTY 1 cut(s) 129
AspLEI GCGC 1 cut(s) 370
AspS9I GGNCC 2 cut(s) 10, 222
AvaI CYCGRG 1 cut(s) 308
AvaII GGWCC 2 cut(s) 10, 222
BbsI GAAGAC 2 cut(s) 87, 276
BbvI GCAGC 1 cut(s) 219
BccI CCATC 1 cut(s) 103
BciT130I CCWGG 4 cut(s) 188, 229, 277, 356
BcoDI GTCTC 3 cut(s) 8, 133, 415
BfmI CTRYAG 1 cut(s) 338
BfuAI ACCTGC 1 cut(s) 21
BisI GCNGC 1 cut(s) 233
BlsI GCNGC 1 cut(s) 234
Bme1390I CCNGG 4 cut(s) 188, 229, 277, 356
Bme18I GGWCC 2 cut(s) 10, 222
BmeT110I CYCGRG 1 cut(s) 308
BmgT120I GGNCC 2 cut(s) 10, 222
BmrFI CCNGG 4 cut(s) 188, 229, 277, 356
BpiI GAAGAC 2 cut(s) 87, 276
BpuEI CTTGAG 1 cut(s) 157
BsaJI CCNNGG 4 cut(s) 104, 186, 354, 355
Bse3DI GCAATG 1 cut(s) 85
BseBI CCWGG 4 cut(s) 188, 229, 277, 356
BseDI CCNNGG 4 cut(s) 104, 186, 354, 355
BseGI GGATG 2 cut(s) 114, 285
BseMI GCAATG 1 cut(s) 85
BseXI GCAGC 1 cut(s) 219
BsiHKCI CYCGRG 1 cut(s) 308
BsmAI GTCTC 3 cut(s) 8, 133, 415
BsoBI CYCGRG 1 cut(s) 308
Bsp143I GATC 1 cut(s) 148
BspACI CCGC 1 cut(s) 225
BspMI ACCTGC 1 cut(s) 21
BspPI GGATC 1 cut(s) 143
BsrDI GCAATG 1 cut(s) 85
BssECI CCNNGG 4 cut(s) 104, 186, 354, 355
BssMI GATC 1 cut(s) 148
Bst2UI CCWGG 4 cut(s) 188, 229, 277, 356
Bst4CI ACNGT 1 cut(s) 342
BstC8I GCNNGC 1 cut(s) 125
BstF5I GGATG 2 cut(s) 114, 285
BstHHI GCGC 1 cut(s) 370
BstKTI GATC 1 cut(s) 151
BstMAI GTCTC 3 cut(s) 8, 133, 415
BstMBI GATC 1 cut(s) 148
BstNI CCWGG 4 cut(s) 188, 229, 277, 356
BstNSI RCATGY 2 cut(s) 94, 246
BstSCI CCNGG 4 cut(s) 186, 227, 275, 354
BstSFI CTRYAG 1 cut(s) 338
BstV1I GCAGC 1 cut(s) 219
BstV2I GAAGAC 2 cut(s) 87, 276
BstX2I RGATCY 1 cut(s) 148
BstYI RGATCY 1 cut(s) 148
BtsCI GGATG 2 cut(s) 114, 285
BveI ACCTGC 1 cut(s) 21
Cac8I GCNNGC 1 cut(s) 125
CfoI GCGC 1 cut(s) 370
Cfr13I GGNCC 2 cut(s) 10, 222
Csp6I GTAC 1 cut(s) 66
CviAII CATG 2 cut(s) 91, 243
CviJI RGCY 4 cut(s) 20, 232, 386, 415
CviKI_1 RGCY 4 cut(s) 20, 232, 386, 415
CviQI GTAC 1 cut(s) 66
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
Eco47I GGWCC 2 cut(s) 10, 222
Eco88I CYCGRG 1 cut(s) 308
EcoO109I RGGNCCY 1 cut(s) 10
EcoRII CCWGG 4 cut(s) 186, 227, 275, 354
FaeI CATG 2 cut(s) 94, 246
FaiI YATR 2 cut(s) 92, 244
FatI CATG 2 cut(s) 90, 242
Fnu4HI GCNGC 1 cut(s) 233
FokI GGATG 2 cut(s) 121, 292
Fsp4HI GCNGC 1 cut(s) 233
FspI TGCGCA 1 cut(s) 369
GlaI GCGC 1 cut(s) 369
GluI GCNGC 1 cut(s) 233
HhaI GCGC 1 cut(s) 370
Hin1II CATG 2 cut(s) 94, 246
Hin6I GCGC 1 cut(s) 368
HinP1I GCGC 1 cut(s) 368
HinfI GANTC 3 cut(s) 160, 378, 391
Hpy188III TCNNGA 5 cut(s) 136, 157, 220, 375, 429
HpyAV CCTTC 3 cut(s) 163, 330, 426
HpyCH4III ACNGT 1 cut(s) 342
HpyCH4V TGCA 4 cut(s) 30, 90, 127, 298
Hsp92II CATG 2 cut(s) 94, 246
HspAI GCGC 1 cut(s) 368
Kzo9I GATC 1 cut(s) 148
LmnI GCTCC 1 cut(s) 120
Lsp1109I GCAGC 1 cut(s) 219
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MboII GAAGA 2 cut(s) 87, 276
MflI RGATCY 1 cut(s) 148
MluCI AATT 3 cut(s) 129, 191, 326
MlyI GAGTC 1 cut(s) 372
MnlI CCTC 4 cut(s) 23, 99, 304, 317
MspR9I CCNGG 4 cut(s) 188, 229, 277, 356
MvaI CCWGG 4 cut(s) 188, 229, 277, 356
NdeII GATC 1 cut(s) 148
NlaIII CATG 2 cut(s) 94, 246
NsbI TGCGCA 1 cut(s) 369
NspI RCATGY 2 cut(s) 94, 246
PaeR7I CTCGAG 1 cut(s) 308
PasI CCCWGGG 1 cut(s) 355
PciI ACATGT 1 cut(s) 242
PfeI GAWTC 2 cut(s) 160, 391
PkrI GCNGC 1 cut(s) 234
PleI GAGTC 1 cut(s) 372
PpsI GAGTC 1 cut(s) 372
PpuMI RGGWCCY 1 cut(s) 10
PscI ACATGT 1 cut(s) 242
Psp5II RGGWCCY 1 cut(s) 10
Psp6I CCWGG 4 cut(s) 186, 227, 275, 354
PspGI CCWGG 4 cut(s) 186, 227, 275, 354
PspPI GGNCC 2 cut(s) 10, 222
PspPPI RGGWCCY 1 cut(s) 10
PspXI VCTCGAGB 1 cut(s) 308
PsuI RGATCY 1 cut(s) 148
RsaI GTAC 1 cut(s) 67
RsaNI GTAC 1 cut(s) 66
SatI GCNGC 1 cut(s) 233
Sau3AI GATC 1 cut(s) 148
Sau96I GGNCC 2 cut(s) 10, 222
SchI GAGTC 1 cut(s) 372
ScrFI CCNGG 4 cut(s) 188, 229, 277, 356
SetI ASST 6 cut(s) 12, 22, 35, 60, 309, 417
SfcI CTRYAG 1 cut(s) 338
Sfr274I CTCGAG 1 cut(s) 308
SinI GGWCC 2 cut(s) 10, 222
SlaI CTCGAG 1 cut(s) 308
SmlI CTYRAG 3 cut(s) 5, 136, 308
SmoI CTYRAG 3 cut(s) 5, 136, 308
Sse9I AATT 3 cut(s) 129, 191, 326
SsiI CCGC 1 cut(s) 225
StyD4I CCNGG 4 cut(s) 186, 227, 275, 354
TaaI ACNGT 1 cut(s) 342
TaqI TCGA 1 cut(s) 309
TasI AATT 3 cut(s) 129, 191, 326
TfiI GAWTC 2 cut(s) 160, 391
TseI GCWGC 1 cut(s) 232
VpaK11BI GGWCC 2 cut(s) 10, 222
XapI RAATTY 1 cut(s) 129
XceI RCATGY 2 cut(s) 94, 246
XhoI CTCGAG 1 cut(s) 308
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.