Rorug07G0037700

Subunit of clathrin-associated adaptor protein complex that plays a role in protein sorting in the late-Golgi trans-Golgi network (TGN) and or endosomes. The AP complexes mediate both the recruitment of clathrin to membranes and the recognition of sorting signals within the cytosolic tails of transmembrane cargo molecules

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
OG0006717
Physical Location & Seq
Reverse (-)
2675729 .. 2677004
1276 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0037700.1

Sequence Viewer

Length: 285 bp
ATGAAGGATTTATTCCCAGATGGGATTCCTTCGTCGGTTGACAACAAGATCAATGTAGGTCTACTAGATGTGCTCATGTTTTCTGTCTTTGATTCATATGAGGCTCATGAACAAGTCCTTGGCATAAAGGTGATAGACCCTGAGAAGACACCAGTAATATTTTCCTGGATTAAAGCTATAAATGAGCTACCTGTGGTGAAAGAGCTGCATATTCCTCATGAAAAAGTGGTGGCATCTGTCAAGCTTTTTAGAAAATTGGCCATGAATTCTTCTTCAGATACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0005911 GO:0009506 GO:0016020 GO:0030054 GO:0044464 GO:0055044 GO:0071944
KEGG Pathways
Metabolic & Signaling
ko04142 map04142
Pfam Domains
Protein Families
Adaptin_N Alpha_adaptinC2 B2-adapt-app_C

Protein Analysis

94

Amino Acids

10.52

Weight (kDa)

5.49

Isoelectric Point (pI)

23.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 61
AcoI YGGCCR 1 cut(s) 258
AcsI RAATTY 1 cut(s) 265
AcuI CTGAAG 1 cut(s) 258
AjnI CCWGG 1 cut(s) 164
AjuI GAANNNNNNNTTGG 2 cut(s) 102, 134
AluBI AGCT 4 cut(s) 176, 187, 205, 244
AluI AGCT 4 cut(s) 176, 187, 205, 244
Alw21I GWGCWC 1 cut(s) 75
AoxI GGCC 1 cut(s) 258
ApeKI GCWGC 1 cut(s) 205
ApoI RAATTY 1 cut(s) 265
AsuHPI GGTGA 2 cut(s) 142, 208
BalI TGGCCA 1 cut(s) 260
BbsI GAAGAC 1 cut(s) 152
Bbv12I GWGCWC 1 cut(s) 75
BbvI GCAGC 1 cut(s) 192
BccI CCATC 1 cut(s) 14
BciT130I CCWGG 1 cut(s) 166
BfaI CTAG 1 cut(s) 65
BisI GCNGC 1 cut(s) 206
BlsI GCNGC 1 cut(s) 207
Bme1390I CCNGG 1 cut(s) 166
BmrFI CCNGG 1 cut(s) 166
BmsI GCATC 1 cut(s) 242
BpiI GAAGAC 1 cut(s) 152
BsaJI CCNNGG 1 cut(s) 118
Bse1I ACTGG 1 cut(s) 152
BseBI CCWGG 1 cut(s) 166
BseDI CCNNGG 1 cut(s) 118
BseMII CTCAG 1 cut(s) 132
BseNI ACTGG 1 cut(s) 152
BseXI GCAGC 1 cut(s) 192
BshFI GGCC 1 cut(s) 260
BsiHKAI GWGCWC 1 cut(s) 75
BsnI GGCC 1 cut(s) 260
Bsp1286I GDGCHC 1 cut(s) 75
Bsp143I GATC 1 cut(s) 48
BspANI GGCC 1 cut(s) 260
BspCNI CTCAG 1 cut(s) 133
BspHI TCATGA 2 cut(s) 106, 217
BsrI ACTGG 1 cut(s) 152
BssECI CCNNGG 1 cut(s) 118
BssMI GATC 1 cut(s) 48
BssT1I CCWWGG 1 cut(s) 118
Bst2UI CCWGG 1 cut(s) 166
BstDEI CTNAG 1 cut(s) 141
BstKTI GATC 1 cut(s) 51
BstMBI GATC 1 cut(s) 48
BstNI CCWGG 1 cut(s) 166
BstSCI CCNGG 1 cut(s) 164
BstV1I GCAGC 1 cut(s) 192
BstV2I GAAGAC 1 cut(s) 152
BsuRI GGCC 1 cut(s) 260
CciI TCATGA 2 cut(s) 106, 217
CviAII CATG 4 cut(s) 76, 107, 218, 262
CviJI RGCY 6 cut(s) 104, 176, 187, 205, 244, 260
CviKI_1 RGCY 6 cut(s) 104, 176, 187, 205, 244, 260
DdeI CTNAG 1 cut(s) 141
DpnI GATC 1 cut(s) 50
DpnII GATC 1 cut(s) 48
EaeI YGGCCR 1 cut(s) 258
Eco130I CCWWGG 1 cut(s) 118
Eco57I CTGAAG 1 cut(s) 258
EcoRI GAATTC 1 cut(s) 265
EcoRII CCWGG 1 cut(s) 164
EcoT14I CCWWGG 1 cut(s) 118
ErhI CCWWGG 1 cut(s) 118
FaeI CATG 4 cut(s) 79, 110, 221, 265
FaiI YATR 9 cut(s) 77, 97, 99, 108, 125, 179, 210, 219, 263
FatI CATG 4 cut(s) 75, 106, 217, 261
FauNDI CATATG 1 cut(s) 97
FblI GTMKAC 1 cut(s) 61
Fnu4HI GCNGC 1 cut(s) 206
Fsp4HI GCNGC 1 cut(s) 206
FspBI CTAG 1 cut(s) 65
GluI GCNGC 1 cut(s) 206
HaeIII GGCC 1 cut(s) 260
Hin1II CATG 4 cut(s) 79, 110, 221, 265
HincII GTYRAC 1 cut(s) 40
HindII GTYRAC 1 cut(s) 40
HindIII AAGCTT 1 cut(s) 242
HinfI GANTC 2 cut(s) 25, 92
HphI GGTGA 2 cut(s) 142, 208
Hpy166II GTNNAC 2 cut(s) 40, 62
Hpy188I TCNGA 1 cut(s) 277
Hpy188III TCNNGA 2 cut(s) 107, 218
Hpy8I GTNNAC 2 cut(s) 40, 62
Hpy99I CGWCG 1 cut(s) 37
HpyAV CCTTC 1 cut(s) 39
HpyCH4V TGCA 1 cut(s) 208
HpyF3I CTNAG 1 cut(s) 141
Hsp92II CATG 4 cut(s) 79, 110, 221, 265
Kzo9I GATC 1 cut(s) 48
LpnPI CCDG 6 cut(s) 30, 151, 153, 165, 178, 204
Lsp1109I GCAGC 1 cut(s) 192
LweI GCATC 1 cut(s) 242
MaeI CTAG 1 cut(s) 65
MalI GATC 1 cut(s) 50
MboI GATC 1 cut(s) 48
MboII GAAGA 3 cut(s) 157, 261, 264
MhlI GDGCHC 1 cut(s) 75
MlsI TGGCCA 1 cut(s) 260
MluCI AATT 2 cut(s) 254, 265
MluNI TGGCCA 1 cut(s) 260
MnlI CCTC 2 cut(s) 94, 225
Mox20I TGGCCA 1 cut(s) 260
MscI TGGCCA 1 cut(s) 260
MseI TTAA 1 cut(s) 171
MslI CAYNNNNRTG 1 cut(s) 128
Msp20I TGGCCA 1 cut(s) 260
MspR9I CCNGG 1 cut(s) 166
MvaI CCWGG 1 cut(s) 166
NdeI CATATG 1 cut(s) 97
NdeII GATC 1 cut(s) 48
NlaIII CATG 4 cut(s) 79, 110, 221, 265
PagI TCATGA 2 cut(s) 106, 217
PfeI GAWTC 2 cut(s) 25, 92
PfoI TCCNGGA 1 cut(s) 164
PkrI GCNGC 1 cut(s) 207
Psp6I CCWGG 1 cut(s) 164
PspGI CCWGG 1 cut(s) 164
RseI CAYNNNNRTG 1 cut(s) 128
SaqAI TTAA 1 cut(s) 171
SatI GCNGC 1 cut(s) 206
Sau3AI GATC 1 cut(s) 48
ScrFI CCNGG 1 cut(s) 166
SduI GDGCHC 1 cut(s) 75
SetI ASST 7 cut(s) 61, 132, 178, 189, 193, 207, 246
SfaNI GCATC 1 cut(s) 242
SmiMI CAYNNNNRTG 1 cut(s) 128
Sse9I AATT 2 cut(s) 254, 265
SspI AATATT 1 cut(s) 159
SspMI CTAG 1 cut(s) 65
StyD4I CCNGG 1 cut(s) 164
StyI CCWWGG 1 cut(s) 118
TasI AATT 2 cut(s) 254, 265
TfiI GAWTC 2 cut(s) 25, 92
Tru1I TTAA 1 cut(s) 171
Tru9I TTAA 1 cut(s) 171
TseI GCWGC 1 cut(s) 205
TspDTI ATGAA 5 cut(s) 17, 84, 123, 234, 278
XapI RAATTY 1 cut(s) 265
XmiI GTMKAC 1 cut(s) 61
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.