Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8411395.1

Orthogroup ID

OG0001306

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 995

Gene Structure 995 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8411395.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 868 bp

gttctatgtagcagaggttctccttgcgctggaatatcttcacatgcttgggattgtttatcgtgacctcaagccggagaatgtccttgtaagagatgatggacacataatgctttcagactttgatctttccctgcggtgtgttgtcagcccgactctagttaagtcttcaattcctgagtccgatcccttgcgaaagaacccagtttactgtgcgcaaccgacctgcattgagccctcatgtattcagccatcatgtgtggtgcctacaacatgtttctcccctcgtttcttttcaagtaaatccaagaaagaccgaaaacccaagaatgaaatgggaaaccaagtcagcccattgccagaacttattgctgagccaaccaatgctcggtcgatgtcatttgttgggactcatgagtatttggcaccagaaattatcaaaggtgaaggccatggcagtgctgttgattggtggacttttgggatcttcctgtatgagctattgttcggtaagacccctttcaagggatcagggaatcgagccactctgttcaatgtcgtgggtcagccactgagattcccagaatcgccagtggtcagcttttcagcaagagatctgataaggggcttactagtgaaagaaccgcagcacaggcttgcatacaagcgtggagcaacggagattaaacaacatcccttctttgaaggtgttaattgggcattgattagatgtgcaaccccacctgatatcccaaagccagtcgagtttgagcggctatcatcccccgtaatgtcgtctagtgataaagctactgctgctgcctctcatccagatcaaaacaattatctggaattcgatttcttttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase

Protein Analysis

288

Amino Acids

32.27

Weight (kDa)

6.73

Isoelectric Point (pI)

42.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001306)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G26610 AT5G47750 AT5G55910 AT5G55910
fragaria_vesca	FvH4_3g00260 FvH4_3g42710 FvH4_3g42710 FvH4_3g42710 FvH4_3g42710 FvH4_3g42710 FvH4_3g42710
malus_domestica	MD03G1029500.v1.1 MD09G1025300.v1.1 MD10G1339900.v1.1 MD11G1032900.v1.1
prunus_persica	Prupe.4G002900_v2.0.a1 Prupe.4G002900_v2.0.a1 Prupe.6G025600_v2.0.a1 Prupe.6G025600_v2.0.a1 Prupe.6G025600_v2.0.a1 Prupe.6G025600_v2.0.a1 Prupe.6G025600_v2.0.a1
pyrus_communis	pycom03g02440 pycom10g28980 pycom11g02860
rosa_chinensis	RchiOBHm_Chr5g0000381 RchiOBHm_Chr5g0076451
rosa_laevigata	RLG00000030861 RLG00000030862 RLG00000036620
rosa_multiflora	Rmu_co8411395.1_g000001 Rmu_sc0000369.1_g000018 Rmu_sc0001680.1_g000004 Rmu_ssc0000181.1_g000002 Rmu_ssc0000385.1_g000014
rosa_roxburghii	Rroxscaffold_1G00075770 Rroxscaffold_1G00075780
rosa_rugosa	Rorug04G0383300 Rorug04G0383300 Rorug05G0447900 Rorug05G0448000 Rorug05G0448100
rosa_samantha	Rh5AG003200 Rh5AG502800 Rh5BG004200 Rh5BG524500 Rh5CG003400 Rh5CG548100 Rh5DG003100 Rh5DG003200 Rh5DG536300 Rh7BG161800
rosa_wichuraiana	Rw5G000310 Rw5G046640

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	217
Acc36I	ACCTGC	1 cut(s)	234
AccB1I	GGYRCC	2 cut(s)	263, 425
AccBSI	CCGCTC	1 cut(s)	773
AciI	CCGC	3 cut(s)	137, 645, 773
AclWI	GGATC	3 cut(s)	180, 492, 536
AcsI	RAATTY	1 cut(s)	852
AfiI	CCNNNNNNNGG	5 cut(s)	29, 74, 388, 524, 525
AflIII	ACRYGT	1 cut(s)	273
AgsI	TTSAA	5 cut(s)	172, 298, 524, 554, 705
AhlI	ACTAGT	1 cut(s)	632
AluBI	AGCT	3 cut(s)	500, 601, 810
AluI	AGCT	3 cut(s)	500, 601, 810
AlwI	GGATC	3 cut(s)	180, 492, 536
AlwNI	CAGNNNCTG	1 cut(s)	572
AoxI	GGCC	1 cut(s)	449
ApeKI	GCWGC	3 cut(s)	647, 816, 819
ApoI	RAATTY	1 cut(s)	852
Asp700I	GAANNNNTTC	1 cut(s)	37
AspLEI	GCGC	2 cut(s)	29, 218
AsuHPI	GGTGA	1 cut(s)	456
BanI	GGYRCC	2 cut(s)	263, 425
BanII	GRGCYC	1 cut(s)	238
BbsI	GAAGAC	1 cut(s)	160
BbvI	GCAGC	3 cut(s)	659, 803, 806
BccI	CCATC	2 cut(s)	93, 260
BcuI	ACTAGT	1 cut(s)	632
BfaI	CTAG	3 cut(s)	159, 633, 799
BfuAI	ACCTGC	1 cut(s)	234
BglII	AGATCT	1 cut(s)	614
BisI	GCNGC	4 cut(s)	648, 774, 817, 820
BlpI	GCTNAGC	1 cut(s)	373
BlsI	GCNGC	4 cut(s)	649, 775, 818, 821
BmiI	GGNNCC	2 cut(s)	265, 427
BmrI	ACTGGG	1 cut(s)	198
BmuI	ACTGGG	1 cut(s)	198
BpiI	GAAGAC	1 cut(s)	160
Bpu1102I	GCTNAGC	1 cut(s)	373
BpuEI	CTTGAG	1 cut(s)	54
BsaJI	CCNNGG	1 cut(s)	452
Bsc4I	CCNNNNNNNGG	5 cut(s)	29, 74, 388, 524, 525
Bse1I	ACTGG	3 cut(s)	204, 591, 759
Bse3DI	GCAATG	1 cut(s)	354
BseDI	CCNNGG	1 cut(s)	452
BseGI	GGATG	3 cut(s)	692, 780, 827
BseLI	CCNNNNNNNGG	5 cut(s)	29, 74, 388, 524, 525
BseMI	GCAATG	1 cut(s)	354
BseMII	CTCAG	3 cut(s)	169, 364, 564
BseNI	ACTGG	3 cut(s)	204, 591, 759
BseXI	GCAGC	3 cut(s)	659, 803, 806
Bsh1285I	CGRYCG	1 cut(s)	393
BshFI	GGCC	1 cut(s)	451
BshNI	GGYRCC	2 cut(s)	263, 425
BsiEI	CGRYCG	1 cut(s)	393
BsiSI	CCGG	1 cut(s)	75
BslFI	GGGAC	1 cut(s)	422
BslI	CCNNNNNNNGG	5 cut(s)	29, 74, 388, 524, 525
BsmFI	GGGAC	1 cut(s)	422
BsnI	GGCC	1 cut(s)	451
Bsp1286I	GDGCHC	1 cut(s)	238
Bsp143I	GATC	6 cut(s)	125, 185, 484, 528, 614, 833
Bsp1720I	GCTNAGC	1 cut(s)	373
Bsp19I	CCATGG	1 cut(s)	452
BspACI	CCGC	3 cut(s)	137, 645, 773
BspANI	GGCC	1 cut(s)	451
BspCNI	CTCAG	3 cut(s)	170, 365, 565
BspHI	TCATGA	1 cut(s)	413
BspLI	GGNNCC	2 cut(s)	265, 427
BspMI	ACCTGC	1 cut(s)	234
BspPI	GGATC	3 cut(s)	180, 492, 536
BspT107I	GGYRCC	2 cut(s)	263, 425
BsrBI	CCGCTC	1 cut(s)	773
BsrDI	GCAATG	1 cut(s)	354
BsrI	ACTGG	3 cut(s)	204, 591, 759
BssECI	CCNNGG	1 cut(s)	452
BssMI	GATC	6 cut(s)	125, 185, 484, 528, 614, 833
BssT1I	CCWWGG	1 cut(s)	452
Bst4CI	ACNGT	1 cut(s)	213
BstC8I	GCNNGC	1 cut(s)	658
BstDEI	CTNAG	3 cut(s)	178, 373, 573
BstDSI	CCRYGG	1 cut(s)	452
BstF5I	GGATG	3 cut(s)	692, 780, 827
BstHHI	GCGC	2 cut(s)	29, 218
BstKTI	GATC	6 cut(s)	128, 188, 487, 531, 617, 836
BstMBI	GATC	6 cut(s)	125, 185, 484, 528, 614, 833
BstMCI	CGRYCG	1 cut(s)	393
BstMWI	GCNNNNNNNGC	2 cut(s)	653, 816
BstNSI	RCATGY	2 cut(s)	47, 277
BstV1I	GCAGC	3 cut(s)	659, 803, 806
BstV2I	GAAGAC	1 cut(s)	160
BstX2I	RGATCY	2 cut(s)	484, 614
BstYI	RGATCY	2 cut(s)	484, 614
BsuRI	GGCC	1 cut(s)	451
BtgI	CCRYGG	1 cut(s)	452
BtsCI	GGATG	3 cut(s)	692, 780, 827
BtsI	GCAGTG	1 cut(s)	464
BtsIMutI	CAGTG	3 cut(s)	464, 570, 598
BveI	ACCTGC	1 cut(s)	234
Cac8I	GCNNGC	1 cut(s)	658
CaiI	CAGNNNCTG	1 cut(s)	572
CciI	TCATGA	1 cut(s)	413
CfoI	GCGC	2 cut(s)	29, 218
CviAII	CATG	6 cut(s)	44, 241, 256, 274, 414, 453
DdeI	CTNAG	3 cut(s)	178, 373, 573
DpnI	GATC	6 cut(s)	127, 187, 486, 530, 616, 835
DpnII	GATC	6 cut(s)	125, 185, 484, 528, 614, 833
Eco130I	CCWWGG	1 cut(s)	452
Eco24I	GRGCYC	1 cut(s)	238
Eco32I	GATATC	1 cut(s)	749
EcoRI	GAATTC	1 cut(s)	852
EcoRV	GATATC	1 cut(s)	749
EcoT14I	CCWWGG	1 cut(s)	452
EcoT38I	GRGCYC	1 cut(s)	238
ErhI	CCWWGG	1 cut(s)	452
FaeI	CATG	6 cut(s)	47, 244, 259, 277, 417, 456
FaqI	GGGAC	1 cut(s)	422
FatI	CATG	6 cut(s)	43, 240, 255, 273, 413, 452
Fnu4HI	GCNGC	4 cut(s)	648, 774, 817, 820
FokI	GGATG	3 cut(s)	679, 767, 814
FriOI	GRGCYC	1 cut(s)	238
Fsp4HI	GCNGC	4 cut(s)	648, 774, 817, 820
FspBI	CTAG	3 cut(s)	159, 633, 799
FspI	TGCGCA	1 cut(s)	217
GlaI	GCGC	2 cut(s)	28, 217
GluI	GCNGC	4 cut(s)	648, 774, 817, 820
HaeIII	GGCC	1 cut(s)	451
HapII	CCGG	1 cut(s)	75
HhaI	GCGC	2 cut(s)	29, 218
Hin1II	CATG	6 cut(s)	47, 244, 259, 277, 417, 456
Hin6I	GCGC	2 cut(s)	27, 216
HinP1I	GCGC	2 cut(s)	27, 216
HinfI	GANTC	6 cut(s)	155, 180, 410, 536, 577, 585
HpaII	CCGG	1 cut(s)	75
HphI	GGTGA	1 cut(s)	456
Hpy166II	GTNNAC	2 cut(s)	209, 475
Hpy188I	TCNGA	3 cut(s)	119, 185, 619
Hpy188III	TCNNGA	5 cut(s)	63, 177, 414, 831, 849
Hpy8I	GTNNAC	2 cut(s)	209, 475
HpyAV	CCTTC	3 cut(s)	441, 699, 707
HpyCH4III	ACNGT	1 cut(s)	213
HpyCH4V	TGCA	3 cut(s)	229, 660, 735
HpyF10VI	GCNNNNNNNGC	2 cut(s)	653, 816
HpyF3I	CTNAG	3 cut(s)	178, 373, 573
Hsp92II	CATG	6 cut(s)	47, 244, 259, 277, 417, 456
HspAI	GCGC	2 cut(s)	27, 216
Kzo9I	GATC	6 cut(s)	125, 185, 484, 528, 614, 833
LmnI	GCTCC	1 cut(s)	672
Lsp1109I	GCAGC	3 cut(s)	659, 803, 806
MaeI	CTAG	3 cut(s)	159, 633, 799
MaeIII	GTNAC	1 cut(s)	63
MalI	GATC	6 cut(s)	127, 187, 486, 530, 616, 835
MbiI	CCGCTC	1 cut(s)	773
MboI	GATC	6 cut(s)	125, 185, 484, 528, 614, 833
MboII	GAAGA	3 cut(s)	30, 160, 479
MflI	RGATCY	2 cut(s)	484, 614
MhlI	GDGCHC	1 cut(s)	238
MluCI	AATT	5 cut(s)	172, 433, 713, 842, 852
MlyI	GAGTC	3 cut(s)	149, 189, 404
MnlI	CCTC	5 cut(s)	8, 78, 248, 295, 833
MroXI	GAANNNNTTC	1 cut(s)	37
MseI	TTAA	4 cut(s)	163, 685, 712, 866
MslI	CAYNNNNRTG	1 cut(s)	457
MspI	CCGG	1 cut(s)	75
MwoI	GCNNNNNNNGC	2 cut(s)	653, 816
NcoI	CCATGG	1 cut(s)	452
NdeII	GATC	6 cut(s)	125, 185, 484, 528, 614, 833
NlaIII	CATG	6 cut(s)	47, 244, 259, 277, 417, 456
NlaIV	GGNNCC	2 cut(s)	265, 427
NmuCI	GTSAC	1 cut(s)	63
NsbI	TGCGCA	1 cut(s)	217
NspI	RCATGY	2 cut(s)	47, 277
PagI	TCATGA	1 cut(s)	413
PciI	ACATGT	1 cut(s)	273
PdmI	GAANNNNTTC	1 cut(s)	37
PfeI	GAWTC	3 cut(s)	536, 577, 585
PkrI	GCNGC	4 cut(s)	649, 775, 818, 821
PleI	GAGTC	3 cut(s)	149, 188, 404
PpsI	GAGTC	3 cut(s)	149, 188, 404
PscI	ACATGT	1 cut(s)	273
PspN4I	GGNNCC	2 cut(s)	265, 427
PsrI	GAACNNNNNNTAC	3 cut(s)	33, 192, 224
PstNI	CAGNNNCTG	1 cut(s)	572
PsuI	RGATCY	2 cut(s)	484, 614
RseI	CAYNNNNRTG	1 cut(s)	457
SaqAI	TTAA	4 cut(s)	163, 685, 712, 866
SatI	GCNGC	4 cut(s)	648, 774, 817, 820
Sau3AI	GATC	6 cut(s)	125, 185, 484, 528, 614, 833
SchI	GAGTC	3 cut(s)	149, 189, 404
SduI	GDGCHC	1 cut(s)	238
SetI	ASST	9 cut(s)	19, 70, 228, 446, 502, 603, 710, 746, 812
SmiMI	CAYNNNNRTG	1 cut(s)	457
SmlI	CTYRAG	1 cut(s)	69
SmoI	CTYRAG	1 cut(s)	69
SpeI	ACTAGT	1 cut(s)	632
Sse9I	AATT	5 cut(s)	172, 433, 713, 842, 852
SsiI	CCGC	3 cut(s)	137, 645, 773
SspMI	CTAG	3 cut(s)	159, 633, 799
StyI	CCWWGG	1 cut(s)	452
TaaI	ACNGT	1 cut(s)	213
TaqI	TCGA	4 cut(s)	393, 539, 763, 856
TaqII	GACCGA	2 cut(s)	331, 379
TasI	AATT	5 cut(s)	172, 433, 713, 842, 852
TauI	GCSGC	1 cut(s)	776
TfiI	GAWTC	3 cut(s)	536, 577, 585
Tru1I	TTAA	4 cut(s)	163, 685, 712, 866
Tru9I	TTAA	4 cut(s)	163, 685, 712, 866
TscAI	CASTG	3 cut(s)	464, 577, 598
TseFI	GTSAC	1 cut(s)	63
TseI	GCWGC	3 cut(s)	647, 816, 819
Tsp45I	GTSAC	1 cut(s)	63
TspDTI	ATGAA	1 cut(s)	346
TspGWI	ACGGA	1 cut(s)	693
TspRI	CASTG	3 cut(s)	464, 577, 598
XapI	RAATTY	1 cut(s)	852
XceI	RCATGY	2 cut(s)	47, 277
XcmI	CCANNNNNNNNNTGG	1 cut(s)	332
XmnI	GAANNNNTTC	1 cut(s)	37
XspI	CTAG	3 cut(s)	159, 633, 799

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.