Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8435535.1

Orthogroup ID

OG0004435

Physical Location & Seq

Genomic Coordinates Reverse (-)

526 .. 1536

Gene Structure 1011 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8435535.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1011 bp

gagaagactactttccacggcaaagaagagagagactatcaaggaaggtcttggattgcgccgccgagagatgccaaggctactaatgatcactgttacattccgaaacggcttgtgcatacttggagtggtcacaccaagggtgtgtctgctattaggttcttcccgaattcggggcatttgattctctctgcagggctggatactaaggtgaagatttgggatgtgttcaacactggtaagtgtatgagaacttacatggggcattcgaagggtgttagggatatttgtttttcgaatgatgggagtaagtttttgagtgctggttatgataagaatatcaagtattgggatacggaaactgggcaggtgatatctacattttcgactgggaaggttccctatgtggtgaagcttaatccggatgaggataagcagaatgtgttgttggctgggatgagtgataagaagattgttcagtgggatatgaatgaggggaagatcactcaagagtatgatcagcatttgggtgcggtgaatactattacatttgttgataataatcgaaggtttgttacttccagtgatgacaagtctcttcgtgtatgggagtttgggattcctgtggttatcaagtatattagcgagcctcacatgcattctatgccatcaatttcgttgcaccccaattcgaattggcttgcagcacaaagtatggacaaccagattcttatttacagcactagggagaagtttcagctcaataagaagaagaggtttgcaggacatgttgttgcggggtatgcttgccaagtgaatttctcgcctgatggacggtttgttttctcgggtgatggtgaaggtcgatgctggttttgggattggaagacttgcaaagtcttcaaaactctcagatgtcatgatggggtgtgcattggggcagcttggcatcccttggagcaaagtaaagttgcaacttgtggctgggatggcttgattaaatattggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005681 GO:0005684 GO:0032991 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0071007 GO:0071013 GO:1902494 GO:1990904

KEGG Pathways

Metabolic & Signaling

ko03040 map03040

Pfam Domains

Protein Families

WD40

Protein Analysis

336

Amino Acids

38.35

Weight (kDa)

8.99

Isoelectric Point (pI)

30.52

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004435)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G10580
fragaria_vesca	FvH4_4g34510
malus_domestica	MD13G1091700.v1.1 MD16G1092300.v1.1
prunus_persica	Prupe.1G254100_v2.0.a1 Prupe.1G254100_v2.0.a1 Prupe.1G254100_v2.0.a1 Prupe.7G165100_v2.0.a1
pyrus_communis	pycom13g07960 pycom16g07870
rosa_chinensis	RchiOBHm_Chr4g0443891 RchiOBHm_Chr5g0051731 RchiOBHm_Chr5g0051741
rosa_laevigata	RLG00000005880 RLG00000006045
rosa_multiflora	Rmu_co8435535.1_g000001 Rmu_sc0010179.1_g000004 Rmu_sc0019062.1_g000007
rosa_roxburghii	Rroxscaffold_5G00384460
rosa_rugosa	Rorug04G0348100 Rorug05G0277100.1
rosa_samantha	Rh4AG408600 Rh4BG419700 Rh4CG433700 Rh4DG414700 Rh5AG349300 Rh5BG360800 Rh5BG360900 Rh5CG385500 Rh5DG375700
rosa_wichuraiana	Rw4G035090 Rw5G033000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	358
Acc36I	ACCTGC	1 cut(s)	358
AccIII	TCCGGA	1 cut(s)	421
AciI	CCGC	3 cut(s)	62, 533, 797
AcsI	RAATTY	2 cut(s)	169, 817
AfiI	CCNNNNNNNGG	2 cut(s)	172, 173
AflIII	ACRYGT	1 cut(s)	787
AgsI	TTSAA	2 cut(s)	232, 904
AjuI	GAANNNNNNNTTGG	2 cut(s)	431, 463
AluBI	AGCT	3 cut(s)	415, 760, 944
AluI	AGCT	3 cut(s)	415, 760, 944
Alw26I	GTCTC	2 cut(s)	27, 600
Ama87I	CYCGRG	1 cut(s)	847
Aor13HI	TCCGGA	1 cut(s)	421
ApeKI	GCWGC	2 cut(s)	704, 941
ApoI	RAATTY	2 cut(s)	169, 817
AspLEI	GCGC	1 cut(s)	61
AsuHPI	GGTGA	6 cut(s)	223, 382, 421, 547, 863, 869
AsuII	TTCGAA	3 cut(s)	269, 296, 692
AvaI	CYCGRG	1 cut(s)	847
BaeI	ACNNNNGTAYC	2 cut(s)	195, 228
BarI	GAAGNNNNNNTAC	2 cut(s)	559, 591
BbsI	GAAGAC	3 cut(s)	11, 892, 893
BbvI	GCAGC	2 cut(s)	716, 953
BccI	CCATC	6 cut(s)	296, 676, 824, 848, 917, 983
BceAI	ACGGC	2 cut(s)	34, 125
BciVI	GTATCC	2 cut(s)	196, 346
BclI	TGATCA	2 cut(s)	88, 517
BcoDI	GTCTC	2 cut(s)	27, 600
BfaI	CTAG	1 cut(s)	744
BfmI	CTRYAG	1 cut(s)	192
BfuAI	ACCTGC	1 cut(s)	358
BfuI	GTATCC	2 cut(s)	196, 346
BisI	GCNGC	3 cut(s)	62, 705, 942
BlsI	GCNGC	3 cut(s)	63, 706, 943
BmeT110I	CYCGRG	1 cut(s)	847
BmiI	GGNNCC	1 cut(s)	399
BmrI	ACTGGG	2 cut(s)	372, 399
BmsI	GCATC	3 cut(s)	61, 857, 958
BmuI	ACTGGG	2 cut(s)	372, 399
BpiI	GAAGAC	3 cut(s)	11, 892, 893
Bpu14I	TTCGAA	3 cut(s)	269, 296, 692
BpuEI	CTTGAG	1 cut(s)	492
BsaBI	GATNNNNATC	1 cut(s)	561
BsaJI	CCNNGG	4 cut(s)	16, 75, 138, 954
BsaWI	WCCGGW	1 cut(s)	421
Bsc4I	CCNNNNNNNGG	2 cut(s)	172, 173
Bse1I	ACTGG	4 cut(s)	241, 367, 394, 582
Bse8I	GATNNNNATC	1 cut(s)	561
BseAI	TCCGGA	1 cut(s)	421
BseDI	CCNNGG	4 cut(s)	16, 75, 138, 954
BseGI	GGATG	5 cut(s)	229, 430, 462, 949, 994
BseJI	GATNNNNATC	1 cut(s)	561
BseLI	CCNNNNNNNGG	2 cut(s)	172, 173
BseMII	CTCAG	1 cut(s)	925
BseNI	ACTGG	4 cut(s)	241, 367, 394, 582
BseXI	GCAGC	2 cut(s)	716, 953
BseYI	CCCAGC	2 cut(s)	452, 984
BsiHKCI	CYCGRG	1 cut(s)	847
BsiSI	CCGG	1 cut(s)	422
BslI	CCNNNNNNNGG	2 cut(s)	172, 173
BsmAI	GTCTC	2 cut(s)	27, 600
BsmI	GAATGC	2 cut(s)	265, 658
BsoBI	CYCGRG	1 cut(s)	847
Bsp119I	TTCGAA	3 cut(s)	269, 296, 692
Bsp13I	TCCGGA	1 cut(s)	421
Bsp143I	GATC	3 cut(s)	88, 501, 517
BspACI	CCGC	3 cut(s)	62, 533, 797
BspCNI	CTCAG	1 cut(s)	924
BspEI	TCCGGA	1 cut(s)	421
BspHI	TCATGA	1 cut(s)	919
BspLI	GGNNCC	1 cut(s)	399
BspMAI	CTGCAG	1 cut(s)	196
BspMI	ACCTGC	1 cut(s)	358
BspT104I	TTCGAA	3 cut(s)	269, 296, 692
BsrI	ACTGG	4 cut(s)	241, 367, 394, 582
BssECI	CCNNGG	4 cut(s)	16, 75, 138, 954
BssMI	GATC	3 cut(s)	88, 501, 517
BssT1I	CCWWGG	3 cut(s)	75, 138, 954
Bst4CI	ACNGT	2 cut(s)	95, 837
Bst6I	CTCTTC	3 cut(s)	21, 603, 767
BstAPI	GCANNNNNTGC	1 cut(s)	664
BstBI	TTCGAA	3 cut(s)	269, 296, 692
BstC8I	GCNNGC	3 cut(s)	647, 702, 808
BstDEI	CTNAG	2 cut(s)	207, 911
BstDSI	CCRYGG	1 cut(s)	16
BstF5I	GGATG	5 cut(s)	229, 430, 462, 949, 994
BstHHI	GCGC	1 cut(s)	61
BstKTI	GATC	3 cut(s)	91, 504, 520
BstMAI	GTCTC	2 cut(s)	27, 600
BstMBI	GATC	3 cut(s)	88, 501, 517
BstMWI	GCNNNNNNNGC	4 cut(s)	655, 664, 803, 990
BstNSI	RCATGY	2 cut(s)	658, 791
BstSFI	CTRYAG	1 cut(s)	192
BstV1I	GCAGC	2 cut(s)	716, 953
BstV2I	GAAGAC	3 cut(s)	11, 892, 893
BsuI	GTATCC	2 cut(s)	196, 346
BtgI	CCRYGG	1 cut(s)	16
BtsCI	GGATG	5 cut(s)	229, 430, 462, 949, 994
BtsIMutI	CAGTG	4 cut(s)	91, 234, 485, 589
BveI	ACCTGC	1 cut(s)	358
Cac8I	GCNNGC	3 cut(s)	647, 702, 808
CciI	TCATGA	1 cut(s)	919
CfoI	GCGC	1 cut(s)	61
CviAII	CATG	4 cut(s)	259, 655, 788, 920
DdeI	CTNAG	2 cut(s)	207, 911
DpnI	GATC	3 cut(s)	90, 503, 519
DpnII	GATC	3 cut(s)	88, 501, 517
Eam1104I	CTCTTC	3 cut(s)	21, 603, 767
EarI	CTCTTC	3 cut(s)	21, 603, 767
Eco130I	CCWWGG	3 cut(s)	75, 138, 954
Eco32I	GATATC	1 cut(s)	375
Eco88I	CYCGRG	1 cut(s)	847
EcoRI	GAATTC	1 cut(s)	169
EcoRV	GATATC	1 cut(s)	375
EcoT14I	CCWWGG	3 cut(s)	75, 138, 954
EcoT22I	ATGCAT	1 cut(s)	660
ErhI	CCWWGG	3 cut(s)	75, 138, 954
FaeI	CATG	4 cut(s)	262, 658, 791, 923
FatI	CATG	4 cut(s)	258, 654, 787, 919
FauI	CCCGC	1 cut(s)	790
FbaI	TGATCA	2 cut(s)	88, 517
Fnu4HI	GCNGC	3 cut(s)	62, 705, 942
FokI	GGATG	5 cut(s)	236, 437, 469, 936, 1001
Fsp4HI	GCNGC	3 cut(s)	62, 705, 942
FspBI	CTAG	1 cut(s)	744
GlaI	GCGC	1 cut(s)	60
GluI	GCNGC	3 cut(s)	62, 705, 942
GsaI	CCCAGC	2 cut(s)	456, 988
HapII	CCGG	1 cut(s)	422
HhaI	GCGC	1 cut(s)	61
Hin1II	CATG	4 cut(s)	262, 658, 791, 923
Hin6I	GCGC	1 cut(s)	59
HinP1I	GCGC	1 cut(s)	59
HindIII	AAGCTT	1 cut(s)	413
HinfI	GANTC	3 cut(s)	184, 619, 727
HpaII	CCGG	1 cut(s)	422
HphI	GGTGA	6 cut(s)	223, 382, 421, 547, 863, 869
Hpy188I	TCNGA	2 cut(s)	105, 914
Hpy188III	TCNNGA	4 cut(s)	166, 422, 509, 920
HpyAV	CCTTC	5 cut(s)	39, 265, 388, 561, 854
HpyCH4III	ACNGT	2 cut(s)	95, 837
HpyCH4V	TGCA	9 cut(s)	118, 194, 658, 682, 704, 782, 894, 933, 974
HpyF10VI	GCNNNNNNNGC	4 cut(s)	655, 664, 803, 990
HpyF3I	CTNAG	2 cut(s)	207, 911
Hsp92II	CATG	4 cut(s)	262, 658, 791, 923
HspAI	GCGC	1 cut(s)	59
Kpn2I	TCCGGA	1 cut(s)	421
Ksp22I	TGATCA	2 cut(s)	88, 517
Kzo9I	GATC	3 cut(s)	88, 501, 517
LmnI	GCTCC	1 cut(s)	958
Lsp1109I	GCAGC	2 cut(s)	716, 953
LweI	GCATC	3 cut(s)	61, 857, 958
MaeI	CTAG	1 cut(s)	744
MaeIII	GTNAC	3 cut(s)	95, 131, 574
MalI	GATC	3 cut(s)	90, 503, 519
MboI	GATC	3 cut(s)	88, 501, 517
MluCI	AATT	5 cut(s)	169, 672, 688, 694, 817
MnlI	CCTC	4 cut(s)	421, 487, 660, 768
Mph1103I	ATGCAT	1 cut(s)	660
MroI	TCCGGA	1 cut(s)	421
MseI	TTAA	2 cut(s)	417, 999
MslI	CAYNNNNRTG	1 cut(s)	528
MspI	CCGG	1 cut(s)	422
Mva1269I	GAATGC	2 cut(s)	265, 658
MwoI	GCNNNNNNNGC	4 cut(s)	655, 664, 803, 990
NdeII	GATC	3 cut(s)	88, 501, 517
NlaIII	CATG	4 cut(s)	262, 658, 791, 923
NlaIV	GGNNCC	1 cut(s)	399
NmeAIII	GCCGAG	1 cut(s)	90
NmuCI	GTSAC	1 cut(s)	131
NsiI	ATGCAT	1 cut(s)	660
NspI	RCATGY	2 cut(s)	658, 791
NspV	TTCGAA	3 cut(s)	269, 296, 692
PagI	TCATGA	1 cut(s)	919
PaqCI	CACCTGC	1 cut(s)	358
PciI	ACATGT	1 cut(s)	787
PctI	GAATGC	2 cut(s)	265, 658
PfeI	GAWTC	3 cut(s)	184, 619, 727
PkrI	GCNGC	3 cut(s)	63, 706, 943
PscI	ACATGT	1 cut(s)	787
PspFI	CCCAGC	2 cut(s)	452, 984
PspN4I	GGNNCC	1 cut(s)	399
PstI	CTGCAG	1 cut(s)	196
RseI	CAYNNNNRTG	1 cut(s)	528
SaqAI	TTAA	2 cut(s)	417, 999
SatI	GCNGC	3 cut(s)	62, 705, 942
Sau3AI	GATC	3 cut(s)	88, 501, 517
SfaNI	GCATC	3 cut(s)	61, 857, 958
SfcI	CTRYAG	1 cut(s)	192
SfuI	TTCGAA	3 cut(s)	269, 296, 692
SmiMI	CAYNNNNRTG	1 cut(s)	528
SmlI	CTYRAG	1 cut(s)	507
SmoI	CTYRAG	1 cut(s)	507
Sse9I	AATT	5 cut(s)	169, 672, 688, 694, 817
SsiI	CCGC	3 cut(s)	62, 533, 797
SspI	AATATT	1 cut(s)	1004
SspMI	CTAG	1 cut(s)	744
StyI	CCWWGG	3 cut(s)	75, 138, 954
TaaI	ACNGT	2 cut(s)	95, 837
TaqI	TCGA	6 cut(s)	269, 296, 386, 565, 692, 865
TasI	AATT	5 cut(s)	169, 672, 688, 694, 817
TauI	GCSGC	1 cut(s)	64
TfiI	GAWTC	3 cut(s)	184, 619, 727
Tru1I	TTAA	2 cut(s)	417, 999
Tru9I	TTAA	2 cut(s)	417, 999
TscAI	CASTG	4 cut(s)	98, 241, 485, 589
TseFI	GTSAC	1 cut(s)	131
TseI	GCWGC	2 cut(s)	704, 941
Tsp45I	GTSAC	1 cut(s)	131
TspDTI	ATGAA	1 cut(s)	503
TspGWI	ACGGA	1 cut(s)	371
TspRI	CASTG	4 cut(s)	98, 241, 485, 589
XapI	RAATTY	2 cut(s)	169, 817
XceI	RCATGY	2 cut(s)	658, 791
XspI	CTAG	1 cut(s)	744
Zsp2I	ATGCAT	1 cut(s)	660

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.