Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8506423.1

Orthogroup ID

OG0004796

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1623

Gene Structure 1623 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8506423.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 617 bp

gcttgtatgaaccctcaaagtatgcctgcaattgggcgtttgggtccaacaatgtttttgttaagattggatccgcgggatttggtggtgcaattgcaactgcactgacgaatccagttgaggttttgaaggtgcgactacagatgaatccgaacttgaggaaaggtgcagctggagaagtgcgtgcaatcattggtgaagagggagtgaaagctctttggaagggtgttggccctgctatgactagagctgctacattgactgcatcacaacttgcaacctatgacgaaaccaagcggatgttgattaggtggacaccacttgaagaaggattccatctacatctcacctcaagcacagttgcaggcatggtgagtaccctcctgactgcacctgtagacatgataaaaacccgtctcatgctgcaacaggaatctgaaagagttggaagctatagaaatggatttcattgtgcatatcaggtcctgcgtacagaaggcccaagaggtctttacaaggggagccttgcaatgtttgcaagattgggtccacaaacgacaattacttttgtagtctgtgagaagctacgtgagcttgctggattgaaagcaatctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0005740 GO:0005743 GO:0006810 GO:0006839 GO:0008150 GO:0016020 GO:0016021 GO:0019866 GO:0022857 GO:0031090 GO:0031224 GO:0031966 GO:0031967 GO:0031975 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044429 GO:0044444 GO:0044446 GO:0044464 GO:0051179 GO:0051234 GO:0055085

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Mito_carr

Protein Analysis

204

Amino Acids

22.21

Weight (kDa)

9.68

Isoelectric Point (pI)

30.85

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004796)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G03115 AT4G03115 AT4G03115 AT4G03115 AT4G03115 AT4G03115
fragaria_vesca	FvH4_2g24640 FvH4_2g24640 FvH4_2g24640 FvH4_2g24640 FvH4_2g24640 FvH4_2g24640
malus_domestica	MD03G1275100.v1.1 MD11G1297100.v1.1 MD11G1297200.v1.1
prunus_persica	Prupe.8G251700_v2.0.a1 Prupe.8G251700_v2.0.a1 Prupe.8G251700_v2.0.a1 Prupe.8G251700_v2.0.a1
pyrus_communis	pycom03g21920
rosa_chinensis	RchiOBHm_Chr6g0292471
rosa_laevigata	RLG00000012021
rosa_multiflora	Rmu_co8506423.1_g000001 Rmu_sc0001354.1_g000025
rosa_roxburghii	Rroxscaffold_7G00175030
rosa_rugosa	Rorug06G0226900
rosa_samantha	Rh6AG340200 Rh6BG347500 Rh6CG354500 Rh6DG340300
rosa_wichuraiana	Rw6G029620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	398
AccII	CGCG	1 cut(s)	76
AciI	CCGC	3 cut(s)	74, 76, 297
AclWI	GGATC	2 cut(s)	65, 78
AfaI	GTAC	2 cut(s)	378, 492
AfiI	CCNNNNNNNGG	1 cut(s)	32
AgsI	TTSAA	3 cut(s)	129, 325, 606
AluBI	AGCT	6 cut(s)	172, 214, 250, 452, 585, 594
AluI	AGCT	6 cut(s)	172, 214, 250, 452, 585, 594
Alw26I	GTCTC	1 cut(s)	421
AlwI	GGATC	2 cut(s)	65, 78
AlwNI	CAGNNNCTG	1 cut(s)	486
AoxI	GGCC	2 cut(s)	231, 498
ApeKI	GCWGC	3 cut(s)	169, 250, 423
AspS9I	GGNCC	5 cut(s)	44, 232, 483, 499, 547
AsuHPI	GGTGA	3 cut(s)	208, 339, 384
AvaII	GGWCC	3 cut(s)	44, 483, 547
BamHI	GGATCC	1 cut(s)	70
BbvI	GCAGC	3 cut(s)	181, 237, 410
BccI	CCATC	1 cut(s)	344
BcoDI	GTCTC	1 cut(s)	421
BfaI	CTAG	1 cut(s)	245
BfmI	CTRYAG	3 cut(s)	139, 395, 453
BisI	GCNGC	3 cut(s)	170, 251, 424
BlsI	GCNGC	3 cut(s)	171, 252, 425
Bme18I	GGWCC	3 cut(s)	44, 483, 547
BmgT120I	GGNCC	5 cut(s)	44, 232, 483, 499, 547
BmiI	GGNNCC	4 cut(s)	45, 72, 523, 548
BmsI	GCATC	1 cut(s)	274
BpmI	CTGGAG	1 cut(s)	194
BpuEI	CTTGAG	2 cut(s)	177, 336
BsaAI	YACGTR	1 cut(s)	589
BsaJI	CCNNGG	1 cut(s)	74
Bsc4I	CCNNNNNNNGG	1 cut(s)	32
Bse1I	ACTGG	1 cut(s)	115
Bse3DI	GCAATG	1 cut(s)	536
BseDI	CCNNGG	1 cut(s)	74
BseGI	GGATG	1 cut(s)	305
BseLI	CCNNNNNNNGG	1 cut(s)	32
BseMI	GCAATG	1 cut(s)	536
BseNI	ACTGG	1 cut(s)	115
BseXI	GCAGC	3 cut(s)	181, 237, 410
BsgI	GTGCAG	3 cut(s)	86, 188, 374
Bsh1236I	CGCG	1 cut(s)	76
BshFI	GGCC	2 cut(s)	233, 500
BslI	CCNNNNNNNGG	1 cut(s)	32
BsmAI	GTCTC	1 cut(s)	421
BsmBI	CGTCTC	1 cut(s)	421
BsnI	GGCC	2 cut(s)	233, 500
Bsp143I	GATC	1 cut(s)	70
BspACI	CCGC	3 cut(s)	74, 76, 297
BspANI	GGCC	2 cut(s)	233, 500
BspFNI	CGCG	1 cut(s)	76
BspLI	GGNNCC	4 cut(s)	45, 72, 523, 548
BspPI	GGATC	2 cut(s)	65, 78
BsrDI	GCAATG	1 cut(s)	536
BsrI	ACTGG	1 cut(s)	115
BssECI	CCNNGG	1 cut(s)	74
BssMI	GATC	1 cut(s)	70
Bst4CI	ACNGT	1 cut(s)	360
Bst6I	CTCTTC	1 cut(s)	194
BstAPI	GCANNNNNTGC	1 cut(s)	535
BstBAI	YACGTR	1 cut(s)	589
BstC8I	GCNNGC	4 cut(s)	27, 185, 366, 596
BstDSI	CCRYGG	1 cut(s)	74
BstF5I	GGATG	1 cut(s)	305
BstFNI	CGCG	1 cut(s)	76
BstKTI	GATC	1 cut(s)	73
BstMAI	GTCTC	1 cut(s)	421
BstMBI	GATC	1 cut(s)	70
BstMWI	GCNNNNNNNGC	2 cut(s)	535, 591
BstSFI	CTRYAG	3 cut(s)	139, 395, 453
BstUI	CGCG	1 cut(s)	76
BstV1I	GCAGC	3 cut(s)	181, 237, 410
BstX2I	RGATCY	1 cut(s)	70
BstYI	RGATCY	1 cut(s)	70
BsuRI	GGCC	2 cut(s)	233, 500
BtgI	CCRYGG	1 cut(s)	74
BtsCI	GGATG	1 cut(s)	305
BtsIMutI	CAGTG	1 cut(s)	103
Cac8I	GCNNGC	4 cut(s)	27, 185, 366, 596
CaiI	CAGNNNCTG	1 cut(s)	486
Cfr13I	GGNCC	5 cut(s)	44, 232, 483, 499, 547
Cfr42I	CCGCGG	1 cut(s)	77
Csp6I	GTAC	2 cut(s)	377, 491
CviAII	CATG	3 cut(s)	369, 402, 420
CviJI	RGCY	9 cut(s)	172, 214, 233, 250, 452, 500, 524, 585, 594
CviKI_1	RGCY	9 cut(s)	172, 214, 233, 250, 452, 500, 524, 585, 594
CviQI	GTAC	2 cut(s)	377, 491
DpnI	GATC	1 cut(s)	72
DpnII	GATC	1 cut(s)	70
Eam1104I	CTCTTC	1 cut(s)	194
EarI	CTCTTC	1 cut(s)	194
Eco47I	GGWCC	3 cut(s)	44, 483, 547
EcoO109I	RGGNCCY	1 cut(s)	483
Esp3I	CGTCTC	1 cut(s)	421
FaeI	CATG	3 cut(s)	372, 405, 423
FaiI	YATR	9 cut(s)	8, 23, 241, 284, 370, 403, 421, 455, 477
FatI	CATG	3 cut(s)	368, 401, 419
FauI	CCCGC	1 cut(s)	69
FblI	GTMKAC	1 cut(s)	398
Fnu4HI	GCNGC	3 cut(s)	170, 251, 424
FokI	GGATG	1 cut(s)	312
Fsp4HI	GCNGC	3 cut(s)	170, 251, 424
FspBI	CTAG	1 cut(s)	245
GluI	GCNGC	3 cut(s)	170, 251, 424
GsuI	CTGGAG	1 cut(s)	194
HaeIII	GGCC	2 cut(s)	233, 500
Hin1II	CATG	3 cut(s)	372, 405, 423
HinfI	GANTC	4 cut(s)	111, 147, 332, 433
HphI	GGTGA	3 cut(s)	208, 339, 384
Hpy166II	GTNNAC	3 cut(s)	314, 399, 550
Hpy188I	TCNGA	2 cut(s)	152, 438
Hpy188III	TCNNGA	1 cut(s)	384
Hpy8I	GTNNAC	3 cut(s)	314, 399, 550
HpyAV	CCTTC	4 cut(s)	123, 216, 322, 490
HpyCH4III	ACNGT	1 cut(s)	360
HpyCH4IV	ACGT	1 cut(s)	588
HpyF10VI	GCNNNNNNNGC	2 cut(s)	535, 591
HpySE526I	ACGT	1 cut(s)	588
Hsp92II	CATG	3 cut(s)	372, 405, 423
KspI	CCGCGG	1 cut(s)	77
Kzo9I	GATC	1 cut(s)	70
LmnI	GCTCC	1 cut(s)	521
Lsp1109I	GCAGC	3 cut(s)	181, 237, 410
LweI	GCATC	1 cut(s)	274
MaeI	CTAG	1 cut(s)	245
MaeII	ACGT	1 cut(s)	588
MalI	GATC	1 cut(s)	72
MboI	GATC	1 cut(s)	70
MboII	GAAGA	2 cut(s)	211, 337
MfeI	CAATTG	2 cut(s)	30, 92
MflI	RGATCY	1 cut(s)	70
MluCI	AATT	3 cut(s)	30, 92, 560
MmeI	TCCRAC	2 cut(s)	71, 426
MnlI	CCTC	7 cut(s)	24, 114, 152, 195, 360, 391, 499
MseI	TTAA	1 cut(s)	62
MspA1I	CMGCKG	2 cut(s)	76, 172
MunI	CAATTG	2 cut(s)	30, 92
MvnI	CGCG	1 cut(s)	76
MwoI	GCNNNNNNNGC	2 cut(s)	535, 591
NdeII	GATC	1 cut(s)	70
NlaIII	CATG	3 cut(s)	372, 405, 423
NlaIV	GGNNCC	4 cut(s)	45, 72, 523, 548
PfeI	GAWTC	4 cut(s)	111, 147, 332, 433
PkrI	GCNGC	3 cut(s)	171, 252, 425
Ppu21I	YACGTR	1 cut(s)	589
PpuMI	RGGWCCY	1 cut(s)	483
Psp5II	RGGWCCY	1 cut(s)	483
PspN4I	GGNNCC	4 cut(s)	45, 72, 523, 548
PspPI	GGNCC	5 cut(s)	44, 232, 483, 499, 547
PspPPI	RGGWCCY	1 cut(s)	483
PstNI	CAGNNNCTG	1 cut(s)	486
PsuI	RGATCY	1 cut(s)	70
PvuII	CAGCTG	1 cut(s)	172
RsaI	GTAC	2 cut(s)	378, 492
RsaNI	GTAC	2 cut(s)	377, 491
SacII	CCGCGG	1 cut(s)	77
SaqAI	TTAA	1 cut(s)	62
SatI	GCNGC	3 cut(s)	170, 251, 424
Sau3AI	GATC	1 cut(s)	70
Sau96I	GGNCC	5 cut(s)	44, 232, 483, 499, 547
SfaNI	GCATC	1 cut(s)	274
SfcI	CTRYAG	3 cut(s)	139, 395, 453
Sfr303I	CCGCGG	1 cut(s)	77
SgrBI	CCGCGG	1 cut(s)	77
SinI	GGWCC	3 cut(s)	44, 483, 547
SmlI	CTYRAG	2 cut(s)	156, 351
SmoI	CTYRAG	2 cut(s)	156, 351
Sse9I	AATT	3 cut(s)	30, 92, 560
SsiI	CCGC	3 cut(s)	74, 76, 297
SspMI	CTAG	1 cut(s)	245
TaaI	ACNGT	1 cut(s)	360
TaiI	ACGT	1 cut(s)	591
TasI	AATT	3 cut(s)	30, 92, 560
TfiI	GAWTC	4 cut(s)	111, 147, 332, 433
Tru1I	TTAA	1 cut(s)	62
Tru9I	TTAA	1 cut(s)	62
TscAI	CASTG	1 cut(s)	110
TseI	GCWGC	3 cut(s)	169, 250, 423
TspDTI	ATGAA	3 cut(s)	23, 160, 457
TspRI	CASTG	1 cut(s)	110
VpaK11BI	GGWCC	3 cut(s)	44, 483, 547
XmiI	GTMKAC	1 cut(s)	398
XspI	CTAG	1 cut(s)	245

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.