Rmu_sc0000033.1_g000008

Peroxisomal 2,4-dienoyl-CoA reductase-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000033.1
Physical Location & Seq
Forward (+)
42246 .. 44103
1858 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000033.1_g000008.1.cds

Sequence Viewer

Length: 744 bp
atggagtcaccattcaaggcggaggtactgaagggcaaggtggcgttgttgaccggaggagcctcgggaattgggtacgagatatcagttcagttgggcaaacatggagcctccattgccgtcatgggtcgtcgtaaaaacgtcatcgactctgctgtagaatcccttcactcccttggcattcccgctattggacttgtgggtgatgttcgcaaaagagatgatgcagttagagttttggaatcaactgtcaagcattttggtaggctcgatatccttgtgaatgctgctgctggcaatttccttgtcccgtctgaggatctatccccaaatggatttcgaacagttttagatatagatgctgttggcacctttacgatgtgtcacgaagcactcaagtatctcaagaagggggcaccagggaaggactcatctgtcggtggaacaataataaacataagtgcgactttgcattatacagctacttggtatcaaattcatgtatctgcagcaaaggctgctgttgatagcattacaagaagcttggcattagaatggggaacagattatgatatcagagtcaatggtattgcgccaggacctattgaagacactgctggctttagtaaactcttacctcaggagattttgagccaatttatggtgaatgctcctacaacaaaagtaggacagaaatgggatattgctatggctgcagtatatcttgcgtctaccgcaggttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

247

Amino Acids

26.08

Weight (kDa)

7.02

Isoelectric Point (pI)

31.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 434
Acc36I ACCTGC 1 cut(s) 728
AccB1I GGYRCC 2 cut(s) 368, 415
AccB7I CCANNNNNTGG 1 cut(s) 661
AccI GTMKAC 1 cut(s) 731
AciI CCGC 3 cut(s) 20, 186, 735
AclWI GGATC 1 cut(s) 327
AcsI RAATTY 1 cut(s) 495
AcuI CTGAAG 1 cut(s) 50
AfaI GTAC 2 cut(s) 27, 77
AfiI CCNNNNNNNGG 3 cut(s) 191, 316, 661
AgsI TTSAA 2 cut(s) 16, 608
AjnI CCWGG 2 cut(s) 418, 595
AluBI AGCT 2 cut(s) 482, 543
AluI AGCT 2 cut(s) 482, 543
AlwI GGATC 1 cut(s) 327
Ama87I CYCGRG 1 cut(s) 64
ApeKI GCWGC 5 cut(s) 287, 290, 509, 518, 713
ApoI RAATTY 1 cut(s) 495
Asp700I GAANNNNTTC 1 cut(s) 165
AspLEI GCGC 1 cut(s) 595
AspS9I GGNCC 1 cut(s) 599
AsuHPI GGTGA 2 cut(s) 215, 676
AsuII TTCGAA 1 cut(s) 340
AvaI CYCGRG 1 cut(s) 64
AvaII GGWCC 1 cut(s) 599
AxyI CCTNAGG 1 cut(s) 639
BaeGI GKGCMC 1 cut(s) 418
BaeI ACNNNNGTAYC 2 cut(s) 383, 416
BanI GGYRCC 2 cut(s) 368, 415
BarI GAAGNNNNNNTAC 2 cut(s) 150, 182
BbsI GAAGAC 1 cut(s) 615
BbvI GCAGC 5 cut(s) 274, 277, 505, 521, 700
BceAI ACGGC 1 cut(s) 104
BciT130I CCWGG 2 cut(s) 420, 597
BfmI CTRYAG 3 cut(s) 156, 507, 714
BfuAI ACCTGC 1 cut(s) 728
BisI GCNGC 5 cut(s) 288, 291, 510, 519, 714
BlsI GCNGC 5 cut(s) 289, 292, 511, 520, 715
Bme1390I CCNGG 2 cut(s) 420, 597
Bme18I GGWCC 1 cut(s) 599
BmeT110I CYCGRG 1 cut(s) 64
BmgT120I GGNCC 1 cut(s) 599
BmiI GGNNCC 4 cut(s) 61, 109, 370, 417
BmrFI CCNGG 2 cut(s) 420, 597
BmsI GCATC 2 cut(s) 214, 349
BpiI GAAGAC 1 cut(s) 615
Bpu14I TTCGAA 1 cut(s) 340
BpuEI CTTGAG 2 cut(s) 380, 389
BsaJI CCNNGG 3 cut(s) 63, 175, 419
BsaWI WCCGGW 1 cut(s) 53
Bsc4I CCNNNNNNNGG 3 cut(s) 191, 316, 661
Bse21I CCTNAGG 1 cut(s) 639
Bse3DI GCAATG 1 cut(s) 114
BseBI CCWGG 2 cut(s) 420, 597
BseDI CCNNGG 3 cut(s) 63, 175, 419
BseLI CCNNNNNNNGG 3 cut(s) 191, 316, 661
BseMI GCAATG 1 cut(s) 114
BseMII CTCAG 2 cut(s) 306, 653
BseRI GAGGAG 1 cut(s) 72
BseSI GKGCMC 1 cut(s) 418
BseXI GCAGC 5 cut(s) 274, 277, 505, 521, 700
BshNI GGYRCC 2 cut(s) 368, 415
BsiHKCI CYCGRG 1 cut(s) 64
BsiSI CCGG 1 cut(s) 54
BslFI GGGAC 1 cut(s) 293
BslI CCNNNNNNNGG 3 cut(s) 191, 316, 661
BsmFI GGGAC 1 cut(s) 293
BsmI GAATGC 3 cut(s) 180, 289, 673
BsoBI CYCGRG 1 cut(s) 64
Bsp119I TTCGAA 1 cut(s) 340
Bsp1286I GDGCHC 1 cut(s) 418
Bsp143I GATC 1 cut(s) 319
BspACI CCGC 3 cut(s) 20, 186, 735
BspCNI CTCAG 2 cut(s) 307, 652
BspLI GGNNCC 4 cut(s) 61, 109, 370, 417
BspMAI CTGCAG 2 cut(s) 511, 718
BspMI ACCTGC 1 cut(s) 728
BspPI GGATC 1 cut(s) 327
BspT104I TTCGAA 1 cut(s) 340
BspT107I GGYRCC 2 cut(s) 368, 415
BsrDI GCAATG 1 cut(s) 114
BssECI CCNNGG 3 cut(s) 63, 175, 419
BssMI GATC 1 cut(s) 319
BssT1I CCWWGG 1 cut(s) 175
Bst2UI CCWGG 2 cut(s) 420, 597
Bst4CI ACNGT 2 cut(s) 250, 346
BstAPI GCANNNNNTGC 1 cut(s) 518
BstBI TTCGAA 1 cut(s) 340
BstC8I GCNNGC 2 cut(s) 295, 619
BstDEI CTNAG 2 cut(s) 315, 639
BstHHI GCGC 1 cut(s) 595
BstKTI GATC 1 cut(s) 322
BstMBI GATC 1 cut(s) 319
BstMWI GCNNNNNNNGC 5 cut(s) 116, 515, 518, 713, 734
BstNI CCWGG 2 cut(s) 420, 597
BstSCI CCNGG 2 cut(s) 418, 595
BstSFI CTRYAG 3 cut(s) 156, 507, 714
BstSLI GKGCMC 1 cut(s) 418
BstV1I GCAGC 5 cut(s) 274, 277, 505, 521, 700
BstV2I GAAGAC 1 cut(s) 615
BstX2I RGATCY 1 cut(s) 319
BstYI RGATCY 1 cut(s) 319
Bsu36I CCTNAGG 1 cut(s) 639
BtsI GCAGTG 1 cut(s) 612
BtsIMutI CAGTG 1 cut(s) 612
BveI ACCTGC 1 cut(s) 728
Cac8I GCNNGC 2 cut(s) 295, 619
CfoI GCGC 1 cut(s) 595
Cfr13I GGNCC 1 cut(s) 599
CseI GACGC 1 cut(s) 717
Csp6I GTAC 2 cut(s) 26, 76
CviAII CATG 3 cut(s) 104, 124, 500
CviJI RGCY 9 cut(s) 62, 110, 268, 482, 518, 543, 621, 654, 713
CviKI_1 RGCY 9 cut(s) 62, 110, 268, 482, 518, 543, 621, 654, 713
CviQI GTAC 2 cut(s) 26, 76
DdeI CTNAG 2 cut(s) 315, 639
DpnI GATC 1 cut(s) 321
DpnII GATC 1 cut(s) 319
DrdI GACNNNNNNGTC 1 cut(s) 434
DseDI GACNNNNNNGTC 1 cut(s) 434
EciI GGCGGA 1 cut(s) 35
Eco130I CCWWGG 1 cut(s) 175
Eco32I GATATC 3 cut(s) 84, 274, 574
Eco47I GGWCC 1 cut(s) 599
Eco57I CTGAAG 1 cut(s) 50
Eco81I CCTNAGG 1 cut(s) 639
Eco88I CYCGRG 1 cut(s) 64
EcoO109I RGGNCCY 1 cut(s) 599
EcoRII CCWGG 2 cut(s) 418, 595
EcoRV GATATC 3 cut(s) 84, 274, 574
EcoT14I CCWWGG 1 cut(s) 175
ErhI CCWWGG 1 cut(s) 175
FaeI CATG 3 cut(s) 107, 127, 503
FalI AAGNNNNNCTT 2 cut(s) 451, 483
FaqI GGGAC 1 cut(s) 293
FatI CATG 3 cut(s) 103, 123, 499
FauI CCCGC 1 cut(s) 193
FblI GTMKAC 1 cut(s) 731
Fnu4HI GCNGC 5 cut(s) 288, 291, 510, 519, 714
Fsp4HI GCNGC 5 cut(s) 288, 291, 510, 519, 714
GlaI GCGC 1 cut(s) 594
GluI GCNGC 5 cut(s) 288, 291, 510, 519, 714
HapII CCGG 1 cut(s) 54
HgaI GACGC 1 cut(s) 717
HhaI GCGC 1 cut(s) 595
Hin1II CATG 3 cut(s) 107, 127, 503
Hin6I GCGC 1 cut(s) 593
HinP1I GCGC 1 cut(s) 593
HincII GTYRAC 1 cut(s) 51
HindII GTYRAC 1 cut(s) 51
HindIII AAGCTT 1 cut(s) 541
HinfI GANTC 6 cut(s) 5, 149, 161, 242, 428, 579
HpaII CCGG 1 cut(s) 54
HphI GGTGA 2 cut(s) 215, 676
Hpy166II GTNNAC 3 cut(s) 51, 629, 732
Hpy188I TCNGA 2 cut(s) 316, 578
Hpy188III TCNNGA 4 cut(s) 66, 386, 406, 641
Hpy8I GTNNAC 3 cut(s) 51, 629, 732
Hpy99I CGWCG 1 cut(s) 135
HpyAV CCTTC 4 cut(s) 25, 176, 403, 418
HpyCH4III ACNGT 2 cut(s) 250, 346
HpyCH4IV ACGT 1 cut(s) 141
HpyCH4V TGCA 4 cut(s) 227, 472, 509, 716
HpyF10VI GCNNNNNNNGC 5 cut(s) 116, 515, 518, 713, 734
HpyF3I CTNAG 2 cut(s) 315, 639
HpySE526I ACGT 1 cut(s) 141
Hsp92II CATG 3 cut(s) 107, 127, 503
HspAI GCGC 1 cut(s) 593
Kzo9I GATC 1 cut(s) 319
LmnI GCTCC 3 cut(s) 59, 107, 676
LpnPI CCDG 9 cut(s) 67, 279, 405, 432, 582, 603, 609, 626, 723
Lsp1109I GCAGC 5 cut(s) 274, 277, 505, 521, 700
LweI GCATC 2 cut(s) 214, 349
MaeII ACGT 1 cut(s) 141
MaeIII GTNAC 2 cut(s) 6, 383
MalI GATC 1 cut(s) 321
MboI GATC 1 cut(s) 319
MboII GAAGA 1 cut(s) 620
MflI RGATCY 1 cut(s) 319
MhlI GDGCHC 1 cut(s) 418
MluCI AATT 4 cut(s) 69, 298, 495, 656
MlyI GAGTC 4 cut(s) 14, 143, 422, 588
MnlI CCTC 6 cut(s) 16, 50, 73, 121, 310, 648
MroXI GAANNNNTTC 1 cut(s) 165
MslI CAYNNNNRTG 1 cut(s) 553
MspI CCGG 1 cut(s) 54
MspR9I CCNGG 2 cut(s) 420, 597
Mva1269I GAATGC 3 cut(s) 180, 289, 673
MvaI CCWGG 2 cut(s) 420, 597
MwoI GCNNNNNNNGC 5 cut(s) 116, 515, 518, 713, 734
NdeII GATC 1 cut(s) 319
NlaIII CATG 3 cut(s) 107, 127, 503
NlaIV GGNNCC 4 cut(s) 61, 109, 370, 417
NmuCI GTSAC 2 cut(s) 6, 383
NspV TTCGAA 1 cut(s) 340
PctI GAATGC 3 cut(s) 180, 289, 673
PdmI GAANNNNTTC 1 cut(s) 165
PfeI GAWTC 2 cut(s) 161, 242
PflMI CCANNNNNTGG 1 cut(s) 661
PkrI GCNGC 5 cut(s) 289, 292, 511, 520, 715
PleI GAGTC 4 cut(s) 13, 143, 422, 587
PpsI GAGTC 4 cut(s) 13, 143, 422, 587
PpuMI RGGWCCY 1 cut(s) 599
Psp5II RGGWCCY 1 cut(s) 599
Psp6I CCWGG 2 cut(s) 418, 595
PspGI CCWGG 2 cut(s) 418, 595
PspN4I GGNNCC 4 cut(s) 61, 109, 370, 417
PspPI GGNCC 1 cut(s) 599
PspPPI RGGWCCY 1 cut(s) 599
PstI CTGCAG 2 cut(s) 511, 718
PsuI RGATCY 1 cut(s) 319
RsaI GTAC 2 cut(s) 27, 77
RsaNI GTAC 2 cut(s) 26, 76
RseI CAYNNNNRTG 1 cut(s) 553
SatI GCNGC 5 cut(s) 288, 291, 510, 519, 714
Sau3AI GATC 1 cut(s) 319
Sau96I GGNCC 1 cut(s) 599
SchI GAGTC 4 cut(s) 14, 143, 422, 588
ScrFI CCNGG 2 cut(s) 420, 597
SduI GDGCHC 1 cut(s) 418
SetI ASST 9 cut(s) 27, 42, 144, 374, 484, 545, 604, 640, 742
SfaNI GCATC 2 cut(s) 214, 349
SfcI CTRYAG 3 cut(s) 156, 507, 714
SfuI TTCGAA 1 cut(s) 340
SinI GGWCC 1 cut(s) 599
SmiMI CAYNNNNRTG 1 cut(s) 553
SmlI CTYRAG 2 cut(s) 395, 404
SmoI CTYRAG 2 cut(s) 395, 404
Sse9I AATT 4 cut(s) 69, 298, 495, 656
SsiI CCGC 3 cut(s) 20, 186, 735
StyD4I CCNGG 2 cut(s) 418, 595
StyI CCWWGG 1 cut(s) 175
TaaI ACNGT 2 cut(s) 250, 346
TaiI ACGT 1 cut(s) 144
TaqI TCGA 3 cut(s) 147, 270, 340
TasI AATT 4 cut(s) 69, 298, 495, 656
TfiI GAWTC 2 cut(s) 161, 242
TscAI CASTG 1 cut(s) 619
TseFI GTSAC 2 cut(s) 6, 383
TseI GCWGC 5 cut(s) 287, 290, 509, 518, 713
Tsp45I GTSAC 2 cut(s) 6, 383
TspDTI ATGAA 1 cut(s) 488
TspRI CASTG 1 cut(s) 619
Van91I CCANNNNNTGG 1 cut(s) 661
VpaK11BI GGWCC 1 cut(s) 599
XapI RAATTY 1 cut(s) 495
XcmI CCANNNNNNNNNTGG 1 cut(s) 121
XmiI GTMKAC 1 cut(s) 731
XmnI GAANNNNTTC 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.