Rmu_sc0000033.1_g000009

Peroxisomal 2,4-dienoyl-CoA reductase-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000033.1
Physical Location & Seq
Forward (+)
47680 .. 50526
2847 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000033.1_g000009.1.cds

Sequence Viewer

Length: 894 bp
atggagtcaccattcaaggcggaggtactgaagggcaaggtggcgttgttgaccggaggagcctcgggaattgggtacgagatatcagttcagttgggcaaacatggagcctccattgccgtcatgggtcgtcgtaaaaacgtcatcgactccgctgttgaatcccttcactcccttggcattccggctatcggacttgtgggtgatgttcgcaaaagagatgatgcagttagagttttggaatcaactgtcaagcattttggtaggctcgatatccttgtgaatgctgctgccggcaatttccttgtcccgtctgaggatctatccccaaatggatttcgaacagttttagatatagatgctgttggcacctttacaatgtgtcatgaagcactcaagtatctcaagaagggggcaccagggaaggattcatctgtcggtggagcaataataaacataagtgccactttgcattatacagctacttggtatcaaattcatgtatctgcagcaaaggctgctgttgatagcattacaagaagcttggcattggaatggggcacagattatgatatcagagtcaatggtattgctccaggacctattgaagacactgctggctttagtaaactcttgcctcaagagatattgagcaaatttaaggtgaatgctcctacaacaaaagtaggacagaaatgggatattgctatggctgcagtatatcttgcgtctaccgcagggaaatacatcaatggaacaacattggttgtagatggggcagattggttgaccaaaccttcccatcttccgaaagagagggtaaagcaactgtcccgagctgtggagcgaaggtctagaaatgaaccagttggcattccaaagagcaagctctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

297

Amino Acids

31.7

Weight (kDa)

9.42

Isoelectric Point (pI)

32.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 368, 415
AccI GTMKAC 1 cut(s) 731
AciI CCGC 3 cut(s) 20, 153, 735
AclWI GGATC 1 cut(s) 327
AcsI RAATTY 2 cut(s) 495, 656
AcuI CTGAAG 1 cut(s) 50
AfaI GTAC 2 cut(s) 27, 77
AfiI CCNNNNNNNGG 3 cut(s) 191, 316, 841
AgsI TTSAA 3 cut(s) 16, 161, 608
AjnI CCWGG 2 cut(s) 418, 595
AluBI AGCT 4 cut(s) 482, 543, 839, 889
AluI AGCT 4 cut(s) 482, 543, 839, 889
AlwI GGATC 1 cut(s) 327
Ama87I CYCGRG 2 cut(s) 64, 834
ApeKI GCWGC 5 cut(s) 287, 290, 509, 518, 713
ApoI RAATTY 2 cut(s) 495, 656
Asp700I GAANNNNTTC 1 cut(s) 165
AspS9I GGNCC 1 cut(s) 599
AsuHPI GGTGA 2 cut(s) 215, 676
AsuII TTCGAA 1 cut(s) 340
AvaI CYCGRG 2 cut(s) 64, 834
AvaII GGWCC 1 cut(s) 599
BaeGI GKGCMC 2 cut(s) 418, 563
BaeI ACNNNNGTAYC 2 cut(s) 383, 416
BanI GGYRCC 2 cut(s) 368, 415
BbsI GAAGAC 1 cut(s) 615
BbvI GCAGC 5 cut(s) 274, 277, 505, 521, 700
BccI CCATC 2 cut(s) 767, 810
BceAI ACGGC 1 cut(s) 104
BciT130I CCWGG 2 cut(s) 420, 597
BfaI CTAG 1 cut(s) 855
BfmI CTRYAG 2 cut(s) 507, 714
BisI GCNGC 5 cut(s) 288, 291, 510, 519, 714
BlsI GCNGC 5 cut(s) 289, 292, 511, 520, 715
Bme1390I CCNGG 2 cut(s) 420, 597
Bme18I GGWCC 1 cut(s) 599
BmeT110I CYCGRG 2 cut(s) 64, 834
BmgT120I GGNCC 1 cut(s) 599
BmiI GGNNCC 4 cut(s) 61, 109, 370, 417
BmrFI CCNGG 2 cut(s) 420, 597
BmsI GCATC 2 cut(s) 214, 349
BpiI GAAGAC 1 cut(s) 615
BpmI CTGGAG 1 cut(s) 579
Bpu14I TTCGAA 1 cut(s) 340
BpuEI CTTGAG 3 cut(s) 380, 389, 624
BsaJI CCNNGG 3 cut(s) 63, 175, 419
BsaWI WCCGGW 1 cut(s) 53
BsaXI ACNNNNNCTCC 2 cut(s) 836, 866
Bsc4I CCNNNNNNNGG 3 cut(s) 191, 316, 841
Bse118I RCCGGY 1 cut(s) 293
Bse1I ACTGG 1 cut(s) 866
Bse3DI GCAATG 1 cut(s) 114
BseBI CCWGG 2 cut(s) 420, 597
BseDI CCNNGG 3 cut(s) 63, 175, 419
BseLI CCNNNNNNNGG 3 cut(s) 191, 316, 841
BseMI GCAATG 1 cut(s) 114
BseMII CTCAG 1 cut(s) 306
BseNI ACTGG 1 cut(s) 866
BseRI GAGGAG 1 cut(s) 72
BseSI GKGCMC 2 cut(s) 418, 563
BseXI GCAGC 5 cut(s) 274, 277, 505, 521, 700
BshNI GGYRCC 2 cut(s) 368, 415
BsiHKCI CYCGRG 2 cut(s) 64, 834
BsiSI CCGG 3 cut(s) 54, 185, 294
BslFI GGGAC 2 cut(s) 293, 817
BslI CCNNNNNNNGG 3 cut(s) 191, 316, 841
BsmFI GGGAC 2 cut(s) 293, 817
BsmI GAATGC 4 cut(s) 180, 289, 673, 873
BsoBI CYCGRG 2 cut(s) 64, 834
Bsp119I TTCGAA 1 cut(s) 340
Bsp1286I GDGCHC 2 cut(s) 418, 563
Bsp143I GATC 1 cut(s) 319
BspACI CCGC 3 cut(s) 20, 153, 735
BspCNI CTCAG 1 cut(s) 307
BspHI TCATGA 1 cut(s) 385
BspLI GGNNCC 4 cut(s) 61, 109, 370, 417
BspMAI CTGCAG 2 cut(s) 511, 718
BspPI GGATC 1 cut(s) 327
BspT104I TTCGAA 1 cut(s) 340
BspT107I GGYRCC 2 cut(s) 368, 415
BsrDI GCAATG 1 cut(s) 114
BsrFI RCCGGY 1 cut(s) 293
BsrI ACTGG 1 cut(s) 866
BssAI RCCGGY 1 cut(s) 293
BssECI CCNNGG 3 cut(s) 63, 175, 419
BssMI GATC 1 cut(s) 319
BssT1I CCWWGG 1 cut(s) 175
Bst2UI CCWGG 2 cut(s) 420, 597
Bst4CI ACNGT 3 cut(s) 250, 346, 831
BstAPI GCANNNNNTGC 1 cut(s) 518
BstBI TTCGAA 1 cut(s) 340
BstC8I GCNNGC 3 cut(s) 295, 619, 887
BstDEI CTNAG 1 cut(s) 315
BstKTI GATC 1 cut(s) 322
BstMBI GATC 1 cut(s) 319
BstMWI GCNNNNNNNGC 5 cut(s) 116, 515, 518, 713, 734
BstNI CCWGG 2 cut(s) 420, 597
BstSCI CCNGG 2 cut(s) 418, 595
BstSFI CTRYAG 2 cut(s) 507, 714
BstSLI GKGCMC 2 cut(s) 418, 563
BstV1I GCAGC 5 cut(s) 274, 277, 505, 521, 700
BstV2I GAAGAC 1 cut(s) 615
BstX2I RGATCY 1 cut(s) 319
BstYI RGATCY 1 cut(s) 319
BtsI GCAGTG 1 cut(s) 612
BtsIMutI CAGTG 1 cut(s) 612
Cac8I GCNNGC 3 cut(s) 295, 619, 887
CciI TCATGA 1 cut(s) 385
Cfr10I RCCGGY 1 cut(s) 293
Cfr13I GGNCC 1 cut(s) 599
CseI GACGC 1 cut(s) 717
Csp6I GTAC 2 cut(s) 26, 76
CviAII CATG 4 cut(s) 104, 124, 386, 500
CviQI GTAC 2 cut(s) 26, 76
DdeI CTNAG 1 cut(s) 315
DpnI GATC 1 cut(s) 321
DpnII GATC 1 cut(s) 319
EciI GGCGGA 1 cut(s) 35
Eco130I CCWWGG 1 cut(s) 175
Eco32I GATATC 3 cut(s) 84, 274, 574
Eco47I GGWCC 1 cut(s) 599
Eco57I CTGAAG 1 cut(s) 50
Eco88I CYCGRG 2 cut(s) 64, 834
EcoO109I RGGNCCY 1 cut(s) 599
EcoRII CCWGG 2 cut(s) 418, 595
EcoRV GATATC 3 cut(s) 84, 274, 574
EcoT14I CCWWGG 1 cut(s) 175
ErhI CCWWGG 1 cut(s) 175
FaeI CATG 4 cut(s) 107, 127, 389, 503
FalI AAGNNNNNCTT 2 cut(s) 451, 483
FaqI GGGAC 2 cut(s) 293, 817
FatI CATG 4 cut(s) 103, 123, 385, 499
FblI GTMKAC 1 cut(s) 731
Fnu4HI GCNGC 5 cut(s) 288, 291, 510, 519, 714
Fsp4HI GCNGC 5 cut(s) 288, 291, 510, 519, 714
FspBI CTAG 1 cut(s) 855
GluI GCNGC 5 cut(s) 288, 291, 510, 519, 714
GsuI CTGGAG 1 cut(s) 579
HapII CCGG 3 cut(s) 54, 185, 294
HgaI GACGC 1 cut(s) 717
Hin1II CATG 4 cut(s) 107, 127, 389, 503
HincII GTYRAC 2 cut(s) 51, 789
HindII GTYRAC 2 cut(s) 51, 789
HindIII AAGCTT 1 cut(s) 541
HinfI GANTC 6 cut(s) 5, 149, 161, 242, 428, 579
HpaII CCGG 3 cut(s) 54, 185, 294
HphI GGTGA 2 cut(s) 215, 676
Hpy166II GTNNAC 4 cut(s) 51, 629, 732, 789
Hpy188I TCNGA 4 cut(s) 194, 316, 578, 810
Hpy188III TCNNGA 6 cut(s) 66, 386, 406, 641, 834, 855
Hpy8I GTNNAC 4 cut(s) 51, 629, 732, 789
Hpy99I CGWCG 1 cut(s) 135
HpyAV CCTTC 6 cut(s) 25, 176, 403, 418, 807, 843
HpyCH4III ACNGT 3 cut(s) 250, 346, 831
HpyCH4IV ACGT 1 cut(s) 141
HpyCH4V TGCA 4 cut(s) 227, 472, 509, 716
HpyF10VI GCNNNNNNNGC 5 cut(s) 116, 515, 518, 713, 734
HpyF3I CTNAG 1 cut(s) 315
HpySE526I ACGT 1 cut(s) 141
Hsp92II CATG 4 cut(s) 107, 127, 389, 503
KroI GCCGGC 1 cut(s) 293
KroNI GCCGGC 1 cut(s) 295
Kzo9I GATC 1 cut(s) 319
LmnI GCTCC 6 cut(s) 59, 107, 443, 598, 676, 844
Lsp1109I GCAGC 5 cut(s) 274, 277, 505, 521, 700
LweI GCATC 2 cut(s) 214, 349
MaeI CTAG 1 cut(s) 855
MaeII ACGT 1 cut(s) 141
MaeIII GTNAC 1 cut(s) 6
MalI GATC 1 cut(s) 321
MboI GATC 1 cut(s) 319
MboII GAAGA 2 cut(s) 620, 797
MflI RGATCY 1 cut(s) 319
MhlI GDGCHC 2 cut(s) 418, 563
MluCI AATT 4 cut(s) 69, 298, 495, 656
MlyI GAGTC 3 cut(s) 14, 143, 588
MnlI CCTC 7 cut(s) 16, 50, 73, 121, 310, 648, 810
MroNI GCCGGC 1 cut(s) 293
MroXI GAANNNNTTC 1 cut(s) 165
MseI TTAA 1 cut(s) 660
MslI CAYNNNNRTG 1 cut(s) 553
MspA1I CMGCKG 1 cut(s) 155
MspI CCGG 3 cut(s) 54, 185, 294
MspR9I CCNGG 2 cut(s) 420, 597
Mva1269I GAATGC 4 cut(s) 180, 289, 673, 873
MvaI CCWGG 2 cut(s) 420, 597
MwoI GCNNNNNNNGC 5 cut(s) 116, 515, 518, 713, 734
NaeI GCCGGC 1 cut(s) 295
NdeII GATC 1 cut(s) 319
NgoMIV GCCGGC 1 cut(s) 293
NlaIII CATG 4 cut(s) 107, 127, 389, 503
NlaIV GGNNCC 4 cut(s) 61, 109, 370, 417
NmuCI GTSAC 1 cut(s) 6
NspV TTCGAA 1 cut(s) 340
PagI TCATGA 1 cut(s) 385
PctI GAATGC 4 cut(s) 180, 289, 673, 873
PdiI GCCGGC 1 cut(s) 295
PdmI GAANNNNTTC 1 cut(s) 165
PfeI GAWTC 3 cut(s) 161, 242, 428
PfoI TCCNGGA 1 cut(s) 595
PkrI GCNGC 5 cut(s) 289, 292, 511, 520, 715
PleI GAGTC 3 cut(s) 13, 143, 587
PpsI GAGTC 3 cut(s) 13, 143, 587
PpuMI RGGWCCY 1 cut(s) 599
Psp5II RGGWCCY 1 cut(s) 599
Psp6I CCWGG 2 cut(s) 418, 595
PspGI CCWGG 2 cut(s) 418, 595
PspN4I GGNNCC 4 cut(s) 61, 109, 370, 417
PspPI GGNCC 1 cut(s) 599
PspPPI RGGWCCY 1 cut(s) 599
PstI CTGCAG 2 cut(s) 511, 718
PsuI RGATCY 1 cut(s) 319
RsaI GTAC 2 cut(s) 27, 77
RsaNI GTAC 2 cut(s) 26, 76
RseI CAYNNNNRTG 1 cut(s) 553
SaqAI TTAA 1 cut(s) 660
SatI GCNGC 5 cut(s) 288, 291, 510, 519, 714
Sau3AI GATC 1 cut(s) 319
Sau96I GGNCC 1 cut(s) 599
SchI GAGTC 3 cut(s) 14, 143, 588
ScrFI CCNGG 2 cut(s) 420, 597
SduI GDGCHC 2 cut(s) 418, 563
SfaNI GCATC 2 cut(s) 214, 349
SfcI CTRYAG 2 cut(s) 507, 714
SfuI TTCGAA 1 cut(s) 340
SinI GGWCC 1 cut(s) 599
SmiMI CAYNNNNRTG 1 cut(s) 553
SmlI CTYRAG 3 cut(s) 395, 404, 639
SmoI CTYRAG 3 cut(s) 395, 404, 639
Sse9I AATT 4 cut(s) 69, 298, 495, 656
SsiI CCGC 3 cut(s) 20, 153, 735
SspMI CTAG 1 cut(s) 855
StyD4I CCNGG 2 cut(s) 418, 595
StyI CCWWGG 1 cut(s) 175
TaaI ACNGT 3 cut(s) 250, 346, 831
TaiI ACGT 1 cut(s) 144
TaqI TCGA 3 cut(s) 147, 270, 340
TasI AATT 4 cut(s) 69, 298, 495, 656
TfiI GAWTC 3 cut(s) 161, 242, 428
Tru1I TTAA 1 cut(s) 660
Tru9I TTAA 1 cut(s) 660
TscAI CASTG 1 cut(s) 619
TseFI GTSAC 1 cut(s) 6
TseI GCWGC 5 cut(s) 287, 290, 509, 518, 713
Tsp45I GTSAC 1 cut(s) 6
TspDTI ATGAA 4 cut(s) 402, 420, 488, 876
TspRI CASTG 1 cut(s) 619
VpaK11BI GGWCC 1 cut(s) 599
XapI RAATTY 2 cut(s) 495, 656
XbaI TCTAGA 1 cut(s) 854
XcmI CCANNNNNNNNNTGG 1 cut(s) 121
XmiI GTMKAC 1 cut(s) 731
XmnI GAANNNNTTC 1 cut(s) 165
XspI CTAG 1 cut(s) 855
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.