Rmu_sc0000124.1_g000051

At4g28440-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000124.1
OG0003500
Physical Location & Seq
Forward (+)
202887 .. 205879
2993 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 756 bp
atgtcggaaacgacacagaggatggcgaagcctctgcacaatttcagtttgccgtgggatttgaagtgggggaaccagaaggtggattccgatggcgagcatcggctgggtttgatcggccatcagcgaacttgcatcaccgtggccgtgactgagaaatgtgatgtttatggttttcgtgtggcggccctagaaataatcatgggaagacatcctggagaacttattttcttgactgcaacatcttccttgatgtcgacaaagtcacccttggttttacaaattatgctgaaagatgtgttggatccacggctatctcctcccagcattcaaccggtcttttctcaaatggcaggctcgaaacaagcaccgagcaaaccaaccttcacaaaggttatgcagctccgcccaatgacctctggtgtcgctctcactgtaaaggttgttaatactaagatagtatgcccgaagggacgtgctggtgggcctcgaggccaaatgcgaattgctgattgcttggttggcgatgaaacggcaatgataatcttcacggctagaaacgatcaagtggacttgatgaaagagggttcaactgtaaccctgcgaaatgccaaaattgacatgtttaaaggatcaatgaggcttgctgtggacaaaagtggccgtattgaagttgctgagcctgccaattttaccgtgatggaaaataacaacctatcactcattgaatttgaccgtgtcgatgttgttatatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03030 ko03420 ko03430 ko03440 ko03460 map03030 map03420 map03430 map03440 map03460
Pfam Domains
Protein Families
No domains found.

Protein Analysis

251

Amino Acids

27.64

Weight (kDa)

9.23

Isoelectric Point (pI)

27.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
OB_Ssb-like PF21473 135 - 225 4.6e-39 Single-stranded DNA binding protein Ssb-like, OB fold
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 489
AccB7I CCANNNNNTGG 1 cut(s) 82
AccI GTMKAC 1 cut(s) 257
AciI CCGC 2 cut(s) 185, 406
AclWI GGATC 3 cut(s) 299, 312, 640
AcoI YGGCCR 3 cut(s) 118, 144, 661
AcsI RAATTY 1 cut(s) 728
AfiI CCNNNNNNNGG 1 cut(s) 82
AflIII ACRYGT 1 cut(s) 621
AgeI ACCGGT 1 cut(s) 334
AgsI TTSAA 5 cut(s) 64, 332, 591, 671, 728
AjiI CACGTC 1 cut(s) 476
AjnI CCWGG 1 cut(s) 214
AjuI GAANNNNNNNTTGG 2 cut(s) 284, 316
AluBI AGCT 1 cut(s) 403
AluI AGCT 1 cut(s) 403
AlwI GGATC 3 cut(s) 299, 312, 640
Ama87I CYCGRG 1 cut(s) 489
AoxI GGCC 6 cut(s) 118, 144, 186, 485, 493, 661
ApeKI GCWGC 1 cut(s) 400
ApoI RAATTY 1 cut(s) 728
AsiGI ACCGGT 1 cut(s) 334
AspS9I GGNCC 2 cut(s) 187, 485
AsuHPI GGTGA 2 cut(s) 130, 258
AvaI CYCGRG 1 cut(s) 489
BamHI GGATCC 1 cut(s) 304
BbsI GAAGAC 1 cut(s) 214
BbvI GCAGC 1 cut(s) 412
BccI CCATC 4 cut(s) 16, 86, 129, 694
BceAI ACGGC 6 cut(s) 37, 131, 326, 549, 567, 648
BcgI CGANNNNNNTGC 2 cut(s) 16, 50
BciT130I CCWGG 1 cut(s) 216
BfaI CTAG 2 cut(s) 191, 555
BisI GCNGC 2 cut(s) 186, 401
BlpI GCTNAGC 1 cut(s) 678
BlsI GCNGC 2 cut(s) 187, 402
Bme1390I CCNGG 1 cut(s) 216
BmeT110I CYCGRG 1 cut(s) 489
BmgBI CACGTC 1 cut(s) 476
BmgT120I GGNCC 2 cut(s) 187, 485
BmiI GGNNCC 2 cut(s) 74, 306
BmrFI CCNGG 1 cut(s) 216
BmsI GCATC 2 cut(s) 109, 144
BpiI GAAGAC 1 cut(s) 214
BpmI CTGGAG 1 cut(s) 237
Bpu1102I GCTNAGC 1 cut(s) 678
BsaJI CCNNGG 4 cut(s) 53, 141, 270, 308
BsaWI WCCGGW 1 cut(s) 334
Bsc4I CCNNNNNNNGG 1 cut(s) 82
Bse118I RCCGGY 1 cut(s) 334
Bse3DI GCAATG 1 cut(s) 543
BseBI CCWGG 1 cut(s) 216
BseDI CCNNGG 4 cut(s) 53, 141, 270, 308
BseGI GGATG 2 cut(s) 27, 211
BseLI CCNNNNNNNGG 1 cut(s) 82
BseMI GCAATG 1 cut(s) 543
BseMII CTCAG 2 cut(s) 144, 669
BseRI GAGGAG 1 cut(s) 309
BseXI GCAGC 1 cut(s) 412
BseYI CCCAGC 2 cut(s) 106, 323
BsgI GTGCAG 1 cut(s) 20
BshFI GGCC 6 cut(s) 120, 146, 188, 487, 495, 663
BshTI ACCGGT 1 cut(s) 334
BsiHKCI CYCGRG 1 cut(s) 489
BsiSI CCGG 1 cut(s) 335
BslFI GGGAC 1 cut(s) 486
BslI CCNNNNNNNGG 1 cut(s) 82
BsmFI GGGAC 1 cut(s) 486
BsmI GAATGC 1 cut(s) 327
BsnI GGCC 6 cut(s) 120, 146, 188, 487, 495, 663
BsoBI CYCGRG 1 cut(s) 489
Bsp143I GATC 4 cut(s) 114, 304, 562, 632
Bsp1720I GCTNAGC 1 cut(s) 678
BspACI CCGC 2 cut(s) 185, 406
BspANI GGCC 6 cut(s) 120, 146, 188, 487, 495, 663
BspCNI CTCAG 2 cut(s) 145, 670
BspLI GGNNCC 2 cut(s) 74, 306
BspPI GGATC 3 cut(s) 299, 312, 640
BsrDI GCAATG 1 cut(s) 543
BsrFI RCCGGY 1 cut(s) 334
BssAI RCCGGY 1 cut(s) 334
BssECI CCNNGG 4 cut(s) 53, 141, 270, 308
BssMI GATC 4 cut(s) 114, 304, 562, 632
BssT1I CCWWGG 1 cut(s) 270
Bst2UI CCWGG 1 cut(s) 216
Bst4CI ACNGT 5 cut(s) 142, 436, 595, 697, 737
BstC8I GCNNGC 4 cut(s) 98, 355, 645, 684
BstDEI CTNAG 3 cut(s) 153, 453, 678
BstDSI CCRYGG 3 cut(s) 53, 141, 308
BstF5I GGATG 2 cut(s) 27, 211
BstKTI GATC 4 cut(s) 117, 307, 565, 635
BstMBI GATC 4 cut(s) 114, 304, 562, 632
BstMWI GCNNNNNNNGC 2 cut(s) 522, 683
BstNI CCWGG 1 cut(s) 216
BstNSI RCATGY 1 cut(s) 625
BstSCI CCNGG 1 cut(s) 214
BstV1I GCAGC 1 cut(s) 412
BstV2I GAAGAC 1 cut(s) 214
BstX2I RGATCY 1 cut(s) 304
BstYI RGATCY 1 cut(s) 304
BsuRI GGCC 6 cut(s) 120, 146, 188, 487, 495, 663
BtgI CCRYGG 3 cut(s) 53, 141, 308
BtgZI GCGATG 1 cut(s) 540
BtrI CACGTC 1 cut(s) 476
BtsCI GGATG 2 cut(s) 27, 211
BtsIMutI CAGTG 1 cut(s) 432
Cac8I GCNNGC 4 cut(s) 98, 355, 645, 684
Cfr10I RCCGGY 1 cut(s) 334
Cfr13I GGNCC 2 cut(s) 187, 485
CspAI ACCGGT 1 cut(s) 334
CviAII CATG 2 cut(s) 202, 622
DdeI CTNAG 3 cut(s) 153, 453, 678
DpnI GATC 4 cut(s) 116, 306, 564, 634
DpnII GATC 4 cut(s) 114, 304, 562, 632
DraI TTTAAA 1 cut(s) 628
EaeI YGGCCR 3 cut(s) 118, 144, 661
EciI GGCGGA 1 cut(s) 395
Eco130I CCWWGG 1 cut(s) 270
Eco88I CYCGRG 1 cut(s) 489
EcoRII CCWGG 1 cut(s) 214
EcoT14I CCWWGG 1 cut(s) 270
ErhI CCWWGG 1 cut(s) 270
FaeI CATG 2 cut(s) 205, 625
FaiI YATR 8 cut(s) 171, 203, 287, 398, 463, 623, 752, 754
FalI AAGNNNNNCTT 2 cut(s) 254, 286
FaqI GGGAC 1 cut(s) 486
FatI CATG 2 cut(s) 201, 621
FblI GTMKAC 1 cut(s) 257
Fnu4HI GCNGC 2 cut(s) 186, 401
FokI GGATG 2 cut(s) 34, 198
Fsp4HI GCNGC 2 cut(s) 186, 401
FspBI CTAG 2 cut(s) 191, 555
GluI GCNGC 2 cut(s) 186, 401
GsaI CCCAGC 2 cut(s) 110, 327
GsuI CTGGAG 1 cut(s) 237
HaeIII GGCC 6 cut(s) 120, 146, 188, 487, 495, 663
HapII CCGG 1 cut(s) 335
Hin1II CATG 2 cut(s) 205, 625
HincII GTYRAC 1 cut(s) 258
HindII GTYRAC 1 cut(s) 258
HinfI GANTC 1 cut(s) 86
HpaII CCGG 1 cut(s) 335
HphI GGTGA 2 cut(s) 130, 258
Hpy166II GTNNAC 3 cut(s) 258, 571, 652
Hpy188I TCNGA 2 cut(s) 7, 91
Hpy188III TCNNGA 1 cut(s) 232
Hpy8I GTNNAC 3 cut(s) 258, 571, 652
HpyAV CCTTC 3 cut(s) 73, 394, 463
HpyCH4III ACNGT 5 cut(s) 142, 436, 595, 697, 737
HpyCH4IV ACGT 1 cut(s) 475
HpyCH4V TGCA 4 cut(s) 37, 135, 239, 400
HpyF10VI GCNNNNNNNGC 2 cut(s) 522, 683
HpyF3I CTNAG 3 cut(s) 153, 453, 678
HpySE526I ACGT 1 cut(s) 475
Hsp92II CATG 2 cut(s) 205, 625
Kzo9I GATC 4 cut(s) 114, 304, 562, 632
LmnI GCTCC 1 cut(s) 408
Lsp1109I GCAGC 1 cut(s) 412
LweI GCATC 2 cut(s) 109, 144
MaeI CTAG 2 cut(s) 191, 555
MaeII ACGT 1 cut(s) 475
MaeIII GTNAC 3 cut(s) 148, 264, 595
MalI GATC 4 cut(s) 116, 306, 564, 634
MboI GATC 4 cut(s) 114, 304, 562, 632
MboII GAAGA 3 cut(s) 219, 237, 538
MflI RGATCY 1 cut(s) 304
MluCI AATT 6 cut(s) 40, 282, 504, 615, 688, 728
MmeI TCCRAC 1 cut(s) 282
MnlI CCTC 8 cut(s) 12, 42, 330, 427, 485, 498, 577, 633
MseI TTAA 2 cut(s) 447, 627
MslI CAYNNNNRTG 1 cut(s) 140
MspI CCGG 1 cut(s) 335
MspR9I CCNGG 1 cut(s) 216
Mva1269I GAATGC 1 cut(s) 327
MvaI CCWGG 1 cut(s) 216
MwoI GCNNNNNNNGC 2 cut(s) 522, 683
NdeII GATC 4 cut(s) 114, 304, 562, 632
NlaIII CATG 2 cut(s) 205, 625
NlaIV GGNNCC 2 cut(s) 74, 306
NmuCI GTSAC 2 cut(s) 148, 264
NspI RCATGY 1 cut(s) 625
PaeR7I CTCGAG 1 cut(s) 489
PciI ACATGT 1 cut(s) 621
PctI GAATGC 1 cut(s) 327
PfeI GAWTC 1 cut(s) 86
PflFI GACNNNGTC 2 cut(s) 262, 737
PflMI CCANNNNNTGG 1 cut(s) 82
PfoI TCCNGGA 1 cut(s) 214
PinAI ACCGGT 1 cut(s) 334
PkrI GCNGC 2 cut(s) 187, 402
PscI ACATGT 1 cut(s) 621
Psp6I CCWGG 1 cut(s) 214
PspFI CCCAGC 2 cut(s) 106, 323
PspGI CCWGG 1 cut(s) 214
PspN4I GGNNCC 2 cut(s) 74, 306
PspPI GGNCC 2 cut(s) 187, 485
PspXI VCTCGAGB 1 cut(s) 489
PsuI RGATCY 1 cut(s) 304
PsyI GACNNNGTC 2 cut(s) 262, 737
RseI CAYNNNNRTG 1 cut(s) 140
SalI GTCGAC 1 cut(s) 256
SaqAI TTAA 2 cut(s) 447, 627
SatI GCNGC 2 cut(s) 186, 401
Sau3AI GATC 4 cut(s) 114, 304, 562, 632
Sau96I GGNCC 2 cut(s) 187, 485
ScrFI CCNGG 1 cut(s) 216
SetI ASST 8 cut(s) 84, 386, 396, 405, 419, 444, 478, 717
SfaNI GCATC 2 cut(s) 109, 144
Sfr274I CTCGAG 1 cut(s) 489
SlaI CTCGAG 1 cut(s) 489
SmiMI CAYNNNNRTG 1 cut(s) 140
SmlI CTYRAG 1 cut(s) 489
SmoI CTYRAG 1 cut(s) 489
Sse9I AATT 6 cut(s) 40, 282, 504, 615, 688, 728
SsiI CCGC 2 cut(s) 185, 406
SspMI CTAG 2 cut(s) 191, 555
StyD4I CCNGG 1 cut(s) 214
StyI CCWWGG 1 cut(s) 270
TaaI ACNGT 5 cut(s) 142, 436, 595, 697, 737
TaiI ACGT 1 cut(s) 478
TaqI TCGA 4 cut(s) 257, 359, 490, 741
TasI AATT 6 cut(s) 40, 282, 504, 615, 688, 728
TauI GCSGC 1 cut(s) 188
TfiI GAWTC 1 cut(s) 86
Tru1I TTAA 2 cut(s) 447, 627
Tru9I TTAA 2 cut(s) 447, 627
TscAI CASTG 1 cut(s) 439
TseFI GTSAC 2 cut(s) 148, 264
TseI GCWGC 1 cut(s) 400
Tsp45I GTSAC 2 cut(s) 148, 264
TspDTI ATGAA 2 cut(s) 543, 593
TspRI CASTG 1 cut(s) 439
Tth111I GACNNNGTC 2 cut(s) 262, 737
Van91I CCANNNNNTGG 1 cut(s) 82
XapI RAATTY 1 cut(s) 728
XceI RCATGY 1 cut(s) 625
XhoI CTCGAG 1 cut(s) 489
XmiI GTMKAC 1 cut(s) 257
XspI CTAG 2 cut(s) 191, 555
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.