Rmu_sc0000363.1_g000044

protein At2g33490-like isoform

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000363.1
OG0001635
Physical Location & Seq
Reverse (-)
190145 .. 192376
2232 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000363.1_g000044.1.cds

Sequence Viewer

Length: 444 bp
atgccttatatagctttatgtagcgaagcccaattcagcgatttcgatgaatttgaacacgctcccaactacgttggcatggaagcaggtagttccaggcttgaggttgtcgagccacatgttaggttggttacagagcaacatattgaataccaatttagtggatttgaagacgatggtgatgatgatggcgcagatcatggtgagaatagcaacgattctattgaagatggagaattgagttttgactatagaccaagtaaacagggaatggaagtctctacatcaaggaattcaatggagctgtctcggaaggggtctgatccagctaaatcacaagatgtcttggtctgcaactatcgcaatcgatctcgcttatctgcaaaacagacaaaggtcagagggaagaccgggtgtgtcggccttcaacgctctgatgcctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BAR BAR_3

Protein Analysis

147

Amino Acids

16.38

Weight (kDa)

4.66

Isoelectric Point (pI)

47.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 77
AclWI GGATC 1 cut(s) 317
AcsI RAATTY 2 cut(s) 50, 292
AflIII ACRYGT 1 cut(s) 118
AgsI TTSAA 6 cut(s) 56, 149, 170, 227, 297, 428
AjnI CCWGG 1 cut(s) 95
AluBI AGCT 3 cut(s) 14, 304, 329
AluI AGCT 3 cut(s) 14, 304, 329
Alw26I GTCTC 2 cut(s) 283, 312
AlwI GGATC 1 cut(s) 317
AoxI GGCC 1 cut(s) 421
ApoI RAATTY 2 cut(s) 50, 292
AspLEI GCGC 1 cut(s) 194
AsuC2I CCSGG 1 cut(s) 412
AsuHPI GGTGA 2 cut(s) 191, 215
BbsI GAAGAC 2 cut(s) 177, 413
BccI CCATC 3 cut(s) 170, 182, 224
BciT130I CCWGG 1 cut(s) 97
BcnI CCSGG 1 cut(s) 412
BcoDI GTCTC 2 cut(s) 283, 312
BfmI CTRYAG 1 cut(s) 250
BfuAI ACCTGC 1 cut(s) 77
Bme1390I CCNGG 2 cut(s) 97, 412
BmrFI CCNGG 2 cut(s) 97, 412
BmsI GCATC 1 cut(s) 427
BoxI GACNNNNGTC 1 cut(s) 395
BpiI GAAGAC 2 cut(s) 177, 413
BpuEI CTTGAG 1 cut(s) 122
BpuMI CCSGG 1 cut(s) 412
Bsa29I ATCGAT 1 cut(s) 367
BseBI CCWGG 1 cut(s) 97
BseCI ATCGAT 1 cut(s) 367
BshFI GGCC 1 cut(s) 423
BshVI ATCGAT 1 cut(s) 367
BsiSI CCGG 1 cut(s) 411
BsmAI GTCTC 2 cut(s) 283, 312
BsnI GGCC 1 cut(s) 423
Bsp143I GATC 3 cut(s) 196, 322, 368
BspANI GGCC 1 cut(s) 423
BspDI ATCGAT 1 cut(s) 367
BspMI ACCTGC 1 cut(s) 77
BspPI GGATC 1 cut(s) 317
BssMI GATC 3 cut(s) 196, 322, 368
Bst2UI CCWGG 1 cut(s) 97
BstHHI GCGC 1 cut(s) 194
BstKTI GATC 3 cut(s) 199, 325, 371
BstMAI GTCTC 2 cut(s) 283, 312
BstMBI GATC 3 cut(s) 196, 322, 368
BstMWI GCNNNNNNNGC 2 cut(s) 360, 429
BstNI CCWGG 1 cut(s) 97
BstNSI RCATGY 1 cut(s) 122
BstPAI GACNNNNGTC 1 cut(s) 395
BstSCI CCNGG 2 cut(s) 95, 410
BstSFI CTRYAG 1 cut(s) 250
BstV2I GAAGAC 2 cut(s) 177, 413
BstXI CCANNNNNNTGG 1 cut(s) 161
Bsu15I ATCGAT 1 cut(s) 367
BsuRI GGCC 1 cut(s) 423
BsuTUI ATCGAT 1 cut(s) 367
BveI ACCTGC 1 cut(s) 77
CfoI GCGC 1 cut(s) 194
ClaI ATCGAT 1 cut(s) 367
CviAII CATG 3 cut(s) 79, 119, 200
CviJI RGCY 7 cut(s) 14, 29, 100, 115, 304, 329, 423
CviKI_1 RGCY 7 cut(s) 14, 29, 100, 115, 304, 329, 423
DpnI GATC 3 cut(s) 198, 324, 370
DpnII GATC 3 cut(s) 196, 322, 368
EcoRI GAATTC 1 cut(s) 292
EcoRII CCWGG 1 cut(s) 95
FaeI CATG 3 cut(s) 82, 122, 203
FaiI YATR 8 cut(s) 9, 11, 19, 80, 120, 144, 201, 252
FatI CATG 3 cut(s) 78, 118, 199
GlaI GCGC 1 cut(s) 193
HaeIII GGCC 1 cut(s) 423
HapII CCGG 1 cut(s) 411
HhaI GCGC 1 cut(s) 194
Hin1II CATG 3 cut(s) 82, 122, 203
Hin6I GCGC 1 cut(s) 192
HinP1I GCGC 1 cut(s) 192
HinfI GANTC 1 cut(s) 218
HpaII CCGG 1 cut(s) 411
HphI GGTGA 2 cut(s) 191, 215
Hpy166II GTNNAC 1 cut(s) 263
Hpy188I TCNGA 4 cut(s) 312, 322, 401, 436
Hpy8I GTNNAC 1 cut(s) 263
HpyAV CCTTC 2 cut(s) 307, 434
HpyCH4IV ACGT 1 cut(s) 72
HpyCH4V TGCA 2 cut(s) 354, 383
HpyF10VI GCNNNNNNNGC 2 cut(s) 360, 429
HpySE526I ACGT 1 cut(s) 72
Hsp92II CATG 3 cut(s) 82, 122, 203
HspAI GCGC 1 cut(s) 192
Kzo9I GATC 3 cut(s) 196, 322, 368
LmnI GCTCC 2 cut(s) 67, 301
LpnPI CCDG 6 cut(s) 72, 82, 109, 251, 339, 424
LweI GCATC 1 cut(s) 427
MaeII ACGT 1 cut(s) 72
MaeIII GTNAC 1 cut(s) 130
MalI GATC 3 cut(s) 198, 324, 370
MboI GATC 3 cut(s) 196, 322, 368
MboII GAAGA 3 cut(s) 182, 239, 418
MluCI AATT 5 cut(s) 32, 50, 155, 236, 292
MnlI CCTC 2 cut(s) 97, 395
MspI CCGG 1 cut(s) 411
MspR9I CCNGG 2 cut(s) 97, 412
MvaI CCWGG 1 cut(s) 97
MwoI GCNNNNNNNGC 2 cut(s) 360, 429
NciI CCSGG 1 cut(s) 412
NdeII GATC 3 cut(s) 196, 322, 368
NlaIII CATG 3 cut(s) 82, 122, 203
NspI RCATGY 1 cut(s) 122
PciI ACATGT 1 cut(s) 118
PfeI GAWTC 1 cut(s) 218
PscI ACATGT 1 cut(s) 118
PshAI GACNNNNGTC 1 cut(s) 395
Psp6I CCWGG 1 cut(s) 95
PspGI CCWGG 1 cut(s) 95
Sau3AI GATC 3 cut(s) 196, 322, 368
ScrFI CCNGG 2 cut(s) 97, 412
SetI ASST 8 cut(s) 16, 75, 91, 108, 128, 306, 331, 399
SfaNI GCATC 1 cut(s) 427
SfcI CTRYAG 1 cut(s) 250
SmlI CTYRAG 1 cut(s) 101
SmoI CTYRAG 1 cut(s) 101
Sse9I AATT 5 cut(s) 32, 50, 155, 236, 292
StyD4I CCNGG 2 cut(s) 95, 410
TaiI ACGT 1 cut(s) 75
TaqI TCGA 3 cut(s) 45, 111, 367
TasI AATT 5 cut(s) 32, 50, 155, 236, 292
TfiI GAWTC 1 cut(s) 218
TspDTI ATGAA 1 cut(s) 63
XapI RAATTY 2 cut(s) 50, 292
XceI RCATGY 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.