Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009677.1

Orthogroup ID

OG0001635

Physical Location & Seq

Genomic Coordinates Forward (+)

47532 .. 47861

Gene Structure 330 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009677.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 330 bp

ctgcgacatctttatcttcatcatacattgttctcttctctcctcctctcaaccgtctcacctcctcttcaattgatcaacgtcttctcaattcgatttcaatttcctctaggtggttccacgcttgaggctgtcgagccacatgttaggttggttacagaggagcaacatacagaataccaatttagtggacttgaagacgatggtgcagatcatggtgagaatagcaacgattctattgaagatggagagttgagttttgactatagaccaagtaagcagggaatggaagtctctgcatcaaggaattcaatggaggtgaagctctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

BAR BAR_3

Protein Analysis

109

Amino Acids

12.27

Weight (kDa)

4.8

Isoelectric Point (pI)

45.99

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001635)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G33490 AT2G33490 AT2G33490
fragaria_vesca	FvH4_4g23100 FvH4_4g23100 FvH4_4g23100 FvH4_4g23100 FvH4_4g23100 FvH4_4g23100 FvH4_4g23100 FvH4_4g23100 FvH4_6g54020 FvH4_6g54020 FvH4_6g54020
malus_domestica	MD09G1006200.v1.1 MD13G1125400.v1.1 MD16G1126200.v1.1 MD17G1010200.v1.1
prunus_persica	Prupe.1G220000_v2.0.a1 Prupe.3G310800_v2.0.a1 Prupe.3G310800_v2.0.a1
pyrus_communis	pycom111g00450 pycom13g10930 pycom13g10940 pycom16g10730 pycom17g00470
rosa_chinensis	RchiOBHm_Chr2g0176201 RchiOBHm_Chr4g0429401
rosa_laevigata	RLG00000007073 RLG00000022389
rosa_multiflora	Rmu_sc0000363.1_g000044 Rmu_sc0003708.1_g000020 Rmu_sc0009677.1_g000013 Rmu_sc0009677.1_g000014
rosa_roxburghii	Rroxscaffold_2G00076680 Rroxscaffold_5G00371040
rosa_rugosa	Rorug02G0591700 Rorug04G0235800 Rorug04G0235800
rosa_samantha	Rh2AG670300 Rh2BG681800 Rh2CG644600 Rh2DG695400 Rh4AG291500 Rh4BG297200 Rh4CG312800 Rh4DG294300
rosa_wichuraiana	Rw2G054980 Rw4G025240

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	307
AfiI	CCNNNNNNNGG	1 cut(s)	113
AflIII	ACRYGT	1 cut(s)	142
AgsI	TTSAA	5 cut(s)	71, 101, 197, 242, 312
AluBI	AGCT	1 cut(s)	325
AluI	AGCT	1 cut(s)	325
Alw26I	GTCTC	2 cut(s)	61, 298
ApoI	RAATTY	1 cut(s)	307
AsuHPI	GGTGA	2 cut(s)	51, 230
BbsI	GAAGAC	2 cut(s)	76, 204
BccI	CCATC	2 cut(s)	197, 239
BclI	TGATCA	1 cut(s)	75
BcoDI	GTCTC	2 cut(s)	61, 298
BfaI	CTAG	1 cut(s)	110
BfmI	CTRYAG	1 cut(s)	265
BmiI	GGNNCC	1 cut(s)	118
BmsI	GCATC	1 cut(s)	308
BpiI	GAAGAC	2 cut(s)	76, 204
BpuEI	CTTGAG	1 cut(s)	146
Bsc4I	CCNNNNNNNGG	1 cut(s)	113
BseLI	CCNNNNNNNGG	1 cut(s)	113
BseRI	GAGGAG	4 cut(s)	32, 35, 54, 176
BsgI	GTGCAG	1 cut(s)	228
BslI	CCNNNNNNNGG	1 cut(s)	113
BsmAI	GTCTC	2 cut(s)	61, 298
BsmBI	CGTCTC	1 cut(s)	61
Bsp143I	GATC	2 cut(s)	75, 211
BspLI	GGNNCC	1 cut(s)	118
BssMI	GATC	2 cut(s)	75, 211
Bst4CI	ACNGT	1 cut(s)	55
Bst6I	CTCTTC	2 cut(s)	40, 72
BstKTI	GATC	2 cut(s)	78, 214
BstMAI	GTCTC	2 cut(s)	61, 298
BstMBI	GATC	2 cut(s)	75, 211
BstNSI	RCATGY	1 cut(s)	146
BstSFI	CTRYAG	1 cut(s)	265
BstV2I	GAAGAC	2 cut(s)	76, 204
BstXI	CCANNNNNNTGG	1 cut(s)	188
CviAII	CATG	2 cut(s)	143, 215
CviJI	RGCY	3 cut(s)	131, 139, 325
CviKI_1	RGCY	3 cut(s)	131, 139, 325
DpnI	GATC	2 cut(s)	77, 213
DpnII	GATC	2 cut(s)	75, 211
Eam1104I	CTCTTC	2 cut(s)	40, 72
EarI	CTCTTC	2 cut(s)	40, 72
EcoRI	GAATTC	1 cut(s)	307
Esp3I	CGTCTC	1 cut(s)	61
FaeI	CATG	2 cut(s)	146, 218
FaiI	YATR	5 cut(s)	24, 144, 171, 216, 267
FatI	CATG	2 cut(s)	142, 214
FbaI	TGATCA	1 cut(s)	75
FspBI	CTAG	1 cut(s)	110
Hin1II	CATG	2 cut(s)	146, 218
HinfI	GANTC	1 cut(s)	233
HphI	GGTGA	2 cut(s)	51, 230
Hpy166II	GTNNAC	1 cut(s)	191
Hpy8I	GTNNAC	1 cut(s)	191
HpyCH4III	ACNGT	1 cut(s)	55
HpyCH4IV	ACGT	1 cut(s)	81
HpyCH4V	TGCA	2 cut(s)	209, 299
HpySE526I	ACGT	1 cut(s)	81
Hsp92II	CATG	2 cut(s)	146, 218
Ksp22I	TGATCA	1 cut(s)	75
Kzo9I	GATC	2 cut(s)	75, 211
LmnI	GCTCC	1 cut(s)	163
LpnPI	CCDG	1 cut(s)	266
LweI	GCATC	1 cut(s)	308
MaeI	CTAG	1 cut(s)	110
MaeII	ACGT	1 cut(s)	81
MaeIII	GTNAC	1 cut(s)	154
MalI	GATC	2 cut(s)	77, 213
MboI	GATC	2 cut(s)	75, 211
MboII	GAAGA	6 cut(s)	8, 27, 59, 76, 209, 254
MfeI	CAATTG	1 cut(s)	71
MluCI	AATT	5 cut(s)	71, 90, 101, 182, 307
MnlI	CCTC	8 cut(s)	53, 56, 72, 75, 117, 121, 154, 310
MunI	CAATTG	1 cut(s)	71
NdeII	GATC	2 cut(s)	75, 211
NlaIII	CATG	2 cut(s)	146, 218
NlaIV	GGNNCC	1 cut(s)	118
NspI	RCATGY	1 cut(s)	146
PciI	ACATGT	1 cut(s)	142
PfeI	GAWTC	1 cut(s)	233
PscI	ACATGT	1 cut(s)	142
PspN4I	GGNNCC	1 cut(s)	118
Sau3AI	GATC	2 cut(s)	75, 211
SetI	ASST	6 cut(s)	64, 84, 115, 152, 321, 327
SfaNI	GCATC	1 cut(s)	308
SfcI	CTRYAG	1 cut(s)	265
SmlI	CTYRAG	1 cut(s)	125
SmoI	CTYRAG	1 cut(s)	125
Sse9I	AATT	5 cut(s)	71, 90, 101, 182, 307
SspMI	CTAG	1 cut(s)	110
TaaI	ACNGT	1 cut(s)	55
TaiI	ACGT	1 cut(s)	84
TaqI	TCGA	2 cut(s)	94, 135
TasI	AATT	5 cut(s)	71, 90, 101, 182, 307
TfiI	GAWTC	1 cut(s)	233
TspDTI	ATGAA	1 cut(s)	8
XapI	RAATTY	1 cut(s)	307
XceI	RCATGY	1 cut(s)	146
XspI	CTAG	1 cut(s)	110

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.