Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001310.1

Orthogroup ID

OG0002809

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 804

Gene Structure 804 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001310.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 281 bp

atggtcaggtatcagagaaaggatggggttcaactaactgcaacactatatcttccaccaggctacgatccatccagagatggccctcttccatgtttggtttggtcttaccctggagaattcaaaagcaaagatgcagccggacaagttcgtggttctcctaatgaatttgctgggataggtccaacatcagccctgctctggatggctcgaaggtttgctattttatctggaccaactattcctattattggtgagggtgatgatgaagcaaatgatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Peptidase_S9

Protein Analysis

93

Amino Acids

10.07

Weight (kDa)

4.96

Isoelectric Point (pI)

36.85

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002809)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G47390
fragaria_vesca	FvH4_5g39170 FvH4_5g39170 FvH4_5g39170 FvH4_5g39170 FvH4_5g39170 FvH4_5g39170 FvH4_5g39170 FvH4_5g39170 FvH4_5g39170 FvH4_5g39170
malus_domestica	MD00G1179100.v1.1 MD00G1179200.v1.1 MD03G1294700.v1.1
prunus_persica	Prupe.8G266800_v2.0.a1 Prupe.8G266800_v2.0.a1 Prupe.8G266800_v2.0.a1 Prupe.8G266800_v2.0.a1 Prupe.8G266800_v2.0.a1
pyrus_communis	pycom03g23300 pycom11g27400
rosa_chinensis	RchiOBHm_Chr5g0055721 RchiOBHm_Chr7g0241201 RchiOBHm_Chr7g0241431
rosa_laevigata	RLG00000000582 RLG00000000586
rosa_multiflora	Rmu_sc0001310.1_g000001 Rmu_sc0001952.1_g000001 Rmu_sc0020071.1_g000001 Rmu_sc0020740.1_g000001 Rmu_sc0030862.1_g000001
rosa_roxburghii	Rroxscaffold_3G00219150
rosa_rugosa	Rorug07G0343800
rosa_samantha	Rh7AG498400 Rh7BG469000 Rh7CG515300 Rh7DG483100
rosa_wichuraiana	Rw7G042040 Rw7G042090

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	62
AcsI	RAATTY	2 cut(s)	119, 167
AfiI	CCNNNNNNNGG	2 cut(s)	201, 251
AgsI	TTSAA	2 cut(s)	32, 124
AjnI	CCWGG	2 cut(s)	58, 112
AlwI	GGATC	1 cut(s)	62
AoxI	GGCC	1 cut(s)	82
ApeKI	GCWGC	1 cut(s)	137
ApoI	RAATTY	2 cut(s)	119, 167
AspS9I	GGNCC	3 cut(s)	83, 182, 233
AsuHPI	GGTGA	2 cut(s)	266, 272
AvaII	GGWCC	2 cut(s)	182, 233
BbvI	GCAGC	1 cut(s)	149
BccI	CCATC	4 cut(s)	17, 74, 79, 199
BciT130I	CCWGG	2 cut(s)	60, 114
BisI	GCNGC	1 cut(s)	138
BlsI	GCNGC	1 cut(s)	139
Bme1390I	CCNGG	2 cut(s)	60, 114
Bme18I	GGWCC	2 cut(s)	182, 233
BmgT120I	GGNCC	3 cut(s)	83, 182, 233
BmrFI	CCNGG	2 cut(s)	60, 114
BmsI	GCATC	1 cut(s)	124
BpmI	CTGGAG	1 cut(s)	135
BsaJI	CCNNGG	1 cut(s)	112
Bsc4I	CCNNNNNNNGG	2 cut(s)	201, 251
BseBI	CCWGG	2 cut(s)	60, 114
BseDI	CCNNGG	1 cut(s)	112
BseGI	GGATG	3 cut(s)	28, 71, 210
BseLI	CCNNNNNNNGG	2 cut(s)	201, 251
BseXI	GCAGC	1 cut(s)	149
BseYI	CCCAGC	1 cut(s)	173
BshFI	GGCC	1 cut(s)	84
BsiSI	CCGG	1 cut(s)	141
BslI	CCNNNNNNNGG	2 cut(s)	201, 251
BsnI	GGCC	1 cut(s)	84
Bsp143I	GATC	1 cut(s)	67
BspANI	GGCC	1 cut(s)	84
BspPI	GGATC	1 cut(s)	62
BssECI	CCNNGG	1 cut(s)	112
BssMI	GATC	1 cut(s)	67
Bst2UI	CCWGG	2 cut(s)	60, 114
Bst6I	CTCTTC	1 cut(s)	93
BstF5I	GGATG	3 cut(s)	28, 71, 210
BstKTI	GATC	1 cut(s)	70
BstMBI	GATC	1 cut(s)	67
BstNI	CCWGG	2 cut(s)	60, 114
BstSCI	CCNGG	2 cut(s)	58, 112
BstV1I	GCAGC	1 cut(s)	149
BsuRI	GGCC	1 cut(s)	84
BtsCI	GGATG	3 cut(s)	28, 71, 210
Cfr13I	GGNCC	3 cut(s)	83, 182, 233
CviAII	CATG	1 cut(s)	93
CviJI	RGCY	5 cut(s)	63, 84, 140, 194, 209
CviKI_1	RGCY	5 cut(s)	63, 84, 140, 194, 209
DpnI	GATC	1 cut(s)	69
DpnII	GATC	1 cut(s)	67
Eam1104I	CTCTTC	1 cut(s)	93
EarI	CTCTTC	1 cut(s)	93
Eco47I	GGWCC	2 cut(s)	182, 233
EcoRI	GAATTC	1 cut(s)	119
EcoRII	CCWGG	2 cut(s)	58, 112
FaeI	CATG	1 cut(s)	96
FaiI	YATR	2 cut(s)	49, 94
FatI	CATG	1 cut(s)	92
Fnu4HI	GCNGC	1 cut(s)	138
FokI	GGATG	3 cut(s)	35, 58, 217
Fsp4HI	GCNGC	1 cut(s)	138
GluI	GCNGC	1 cut(s)	138
GsaI	CCCAGC	1 cut(s)	177
GsuI	CTGGAG	1 cut(s)	135
HaeIII	GGCC	1 cut(s)	84
HapII	CCGG	1 cut(s)	141
Hin1II	CATG	1 cut(s)	96
HpaII	CCGG	1 cut(s)	141
HphI	GGTGA	2 cut(s)	266, 272
Hpy188I	TCNGA	1 cut(s)	15
Hpy188III	TCNNGA	3 cut(s)	75, 202, 231
HpyAV	CCTTC	1 cut(s)	207
HpyCH4V	TGCA	2 cut(s)	41, 137
Hsp92II	CATG	1 cut(s)	96
Kzo9I	GATC	1 cut(s)	67
Lsp1109I	GCAGC	1 cut(s)	149
LweI	GCATC	1 cut(s)	124
MalI	GATC	1 cut(s)	69
MboI	GATC	1 cut(s)	67
MboII	GAAGA	2 cut(s)	44, 80
MluCI	AATT	2 cut(s)	119, 167
MmeI	TCCRAC	1 cut(s)	209
MnlI	CCTC	2 cut(s)	96, 250
MspI	CCGG	1 cut(s)	141
MspR9I	CCNGG	2 cut(s)	60, 114
MvaI	CCWGG	2 cut(s)	60, 114
NdeII	GATC	1 cut(s)	67
NlaIII	CATG	1 cut(s)	96
PkrI	GCNGC	1 cut(s)	139
Psp6I	CCWGG	2 cut(s)	58, 112
PspFI	CCCAGC	1 cut(s)	173
PspGI	CCWGG	2 cut(s)	58, 112
PspPI	GGNCC	3 cut(s)	83, 182, 233
SatI	GCNGC	1 cut(s)	138
Sau3AI	GATC	1 cut(s)	67
Sau96I	GGNCC	3 cut(s)	83, 182, 233
ScrFI	CCNGG	2 cut(s)	60, 114
SetI	ASST	3 cut(s)	11, 184, 218
SfaNI	GCATC	1 cut(s)	124
SinI	GGWCC	2 cut(s)	182, 233
Sse9I	AATT	2 cut(s)	119, 167
StyD4I	CCNGG	2 cut(s)	58, 112
TaqI	TCGA	1 cut(s)	211
TasI	AATT	2 cut(s)	119, 167
TseI	GCWGC	1 cut(s)	137
TspDTI	ATGAA	1 cut(s)	180
VpaK11BI	GGWCC	2 cut(s)	182, 233
XapI	RAATTY	2 cut(s)	119, 167
XcmI	CCANNNNNNNNNTGG	1 cut(s)	99

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.