Rmu_sc0001356.1_g000013

Ras-related protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001356.1
Physical Location & Seq
Reverse (-)
47114 .. 47368
255 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001356.1_g000013.1.cds

Sequence Viewer

Length: 255 bp
atgatattggtggggaacaaggttgataaggatgagagcgaaagggatgtgagcactgctggaggtcaagctcttgctaaagagtacgacattgagttctttgaaaccagtgccgagacgaacatgaatgtagaagaggtcttcttttcaatagccagggatatcatgcatgcggaatcaaatgcttctagggtcactcatgagcctcaaacatttgacattcactacaccaaaaactgcatcacacaacactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.54

Weight (kDa)

4.65

Isoelectric Point (pI)

47.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 173
AfaI GTAC 1 cut(s) 86
AgsI TTSAA 2 cut(s) 104, 150
AjnI CCWGG 1 cut(s) 155
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
Alw21I GWGCWC 1 cut(s) 56
Alw26I GTCTC 1 cut(s) 110
BbsI GAAGAC 1 cut(s) 133
Bbv12I GWGCWC 1 cut(s) 56
BciT130I CCWGG 1 cut(s) 157
BcoDI GTCTC 1 cut(s) 110
BfaI CTAG 1 cut(s) 189
Bme1390I CCNGG 1 cut(s) 157
BmrFI CCNGG 1 cut(s) 157
BmsI GCATC 1 cut(s) 249
BpiI GAAGAC 1 cut(s) 133
BpmI CTGGAG 1 cut(s) 81
BsaJI CCNNGG 1 cut(s) 156
Bse1I ACTGG 1 cut(s) 108
BseBI CCWGG 1 cut(s) 157
BseDI CCNNGG 1 cut(s) 156
BseGI GGATG 2 cut(s) 37, 52
BseNI ACTGG 1 cut(s) 108
BsiHKAI GWGCWC 1 cut(s) 56
BsmAI GTCTC 1 cut(s) 110
BsmBI CGTCTC 1 cut(s) 110
Bsp1286I GDGCHC 1 cut(s) 56
BspACI CCGC 1 cut(s) 173
BspHI TCATGA 1 cut(s) 199
BsrI ACTGG 1 cut(s) 108
BssECI CCNNGG 1 cut(s) 156
Bst2UI CCWGG 1 cut(s) 157
Bst6I CTCTTC 1 cut(s) 129
BstC8I GCNNGC 1 cut(s) 171
BstF5I GGATG 2 cut(s) 37, 52
BstMAI GTCTC 1 cut(s) 110
BstNI CCWGG 1 cut(s) 157
BstNSI RCATGY 1 cut(s) 173
BstSCI CCNGG 1 cut(s) 155
BstV2I GAAGAC 1 cut(s) 133
BtsCI GGATG 2 cut(s) 37, 52
BtsI GCAGTG 1 cut(s) 54
BtsIMutI CAGTG 2 cut(s) 54, 115
Cac8I GCNNGC 1 cut(s) 171
CciI TCATGA 1 cut(s) 199
Csp6I GTAC 1 cut(s) 85
CviAII CATG 4 cut(s) 124, 166, 170, 200
CviJI RGCY 3 cut(s) 71, 155, 205
CviKI_1 RGCY 3 cut(s) 71, 155, 205
CviQI GTAC 1 cut(s) 85
Eam1104I CTCTTC 1 cut(s) 129
EarI CTCTTC 1 cut(s) 129
Eco32I GATATC 1 cut(s) 163
EcoRII CCWGG 1 cut(s) 155
EcoRV GATATC 1 cut(s) 163
EcoT22I ATGCAT 1 cut(s) 171
Esp3I CGTCTC 1 cut(s) 110
FaeI CATG 4 cut(s) 127, 169, 173, 203
FaiI YATR 4 cut(s) 125, 167, 171, 201
FatI CATG 4 cut(s) 123, 165, 169, 199
FokI GGATG 2 cut(s) 44, 59
FspBI CTAG 1 cut(s) 189
GsuI CTGGAG 1 cut(s) 81
Hin1II CATG 4 cut(s) 127, 169, 173, 203
HinfI GANTC 1 cut(s) 176
Hpy188III TCNNGA 1 cut(s) 200
HpyCH4V TGCA 2 cut(s) 169, 240
Hsp92II CATG 4 cut(s) 127, 169, 173, 203
LpnPI CCDG 4 cut(s) 45, 121, 142, 169
LweI GCATC 1 cut(s) 249
MaeI CTAG 1 cut(s) 189
MaeIII GTNAC 1 cut(s) 193
MboII GAAGA 2 cut(s) 133, 146
MhlI GDGCHC 1 cut(s) 56
MnlI CCTC 3 cut(s) 56, 130, 216
Mph1103I ATGCAT 1 cut(s) 171
MspR9I CCNGG 1 cut(s) 157
MvaI CCWGG 1 cut(s) 157
NlaIII CATG 4 cut(s) 127, 169, 173, 203
NmeAIII GCCGAG 1 cut(s) 139
NmuCI GTSAC 1 cut(s) 193
NsiI ATGCAT 1 cut(s) 171
NspI RCATGY 1 cut(s) 173
PaeI GCATGC 1 cut(s) 173
PagI TCATGA 1 cut(s) 199
PfeI GAWTC 1 cut(s) 176
Psp6I CCWGG 1 cut(s) 155
PspGI CCWGG 1 cut(s) 155
RsaI GTAC 1 cut(s) 86
RsaNI GTAC 1 cut(s) 85
ScrFI CCNGG 1 cut(s) 157
SduI GDGCHC 1 cut(s) 56
SetI ASST 4 cut(s) 24, 67, 73, 141
SfaNI GCATC 1 cut(s) 249
SphI GCATGC 1 cut(s) 173
SsiI CCGC 1 cut(s) 173
SspMI CTAG 1 cut(s) 189
StyD4I CCNGG 1 cut(s) 155
TfiI GAWTC 1 cut(s) 176
TscAI CASTG 2 cut(s) 61, 115
TseFI GTSAC 1 cut(s) 193
Tsp45I GTSAC 1 cut(s) 193
TspDTI ATGAA 1 cut(s) 140
TspRI CASTG 2 cut(s) 61, 115
XceI RCATGY 1 cut(s) 173
XspI CTAG 1 cut(s) 189
Zsp2I ATGCAT 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.