Rh1CG048000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
8960863 .. 8965393
4531 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG048000.1

Sequence Viewer

Length: 240 bp
ATGCCCAAATTTATAGCAAAGACTGGCGGTCTGTTGAGATCAAGGAGGCTTTGGTGGTCTGTTAGCGGTGGAGTGGCGTATCTGGATTTGTTGTATCATTCTCCGACGCCGACGGTTGTTTGGATATACTCGGTGGTGCAGGCAGATGTTAATAAAGCTATAAAGAGGAGGTCTGGAATCCAAAGAAGAAGGATTTTTAGCAAAGAAAAGCTGCCCAGAAATATAATACATGAAACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

9.16

Weight (kDa)

11.28

Isoelectric Point (pI)

85.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 27, 66
AcsI RAATTY 1 cut(s) 8
AcyI GRCGYC 1 cut(s) 107
AhdI GACNNNNNGTC 1 cut(s) 27
AluBI AGCT 2 cut(s) 158, 211
AluI AGCT 2 cut(s) 158, 211
ApeKI GCWGC 1 cut(s) 211
ApoI RAATTY 1 cut(s) 8
BbvI GCAGC 1 cut(s) 198
BisI GCNGC 1 cut(s) 212
BlsI GCNGC 1 cut(s) 213
BmeRI GACNNNNNGTC 1 cut(s) 27
BsaHI GRCGYC 1 cut(s) 107
Bse1I ACTGG 1 cut(s) 28
BseNI ACTGG 1 cut(s) 28
BseRI GAGGAG 1 cut(s) 181
BseXI GCAGC 1 cut(s) 198
BsgI GTGCAG 1 cut(s) 158
Bsp143I GATC 1 cut(s) 38
BspACI CCGC 2 cut(s) 27, 66
BsrI ACTGG 1 cut(s) 28
BssMI GATC 1 cut(s) 38
BssNI GRCGYC 1 cut(s) 107
Bst4CI ACNGT 1 cut(s) 115
BstACI GRCGYC 1 cut(s) 107
BstC8I GCNNGC 1 cut(s) 141
BstKTI GATC 1 cut(s) 41
BstMBI GATC 1 cut(s) 38
BstV1I GCAGC 1 cut(s) 198
Cac8I GCNNGC 1 cut(s) 141
CseI GACGC 1 cut(s) 115
CviAII CATG 1 cut(s) 230
CviJI RGCY 3 cut(s) 49, 158, 211
CviKI_1 RGCY 3 cut(s) 49, 158, 211
DpnI GATC 1 cut(s) 40
DpnII GATC 1 cut(s) 38
DriI GACNNNNNGTC 1 cut(s) 27
Eam1105I GACNNNNNGTC 1 cut(s) 27
FaeI CATG 1 cut(s) 233
FaiI YATR 5 cut(s) 14, 127, 161, 224, 231
FatI CATG 1 cut(s) 229
Fnu4HI GCNGC 1 cut(s) 212
Fsp4HI GCNGC 1 cut(s) 212
GluI GCNGC 1 cut(s) 212
HgaI GACGC 1 cut(s) 115
Hin1I GRCGYC 1 cut(s) 107
Hin1II CATG 1 cut(s) 233
HinfI GANTC 1 cut(s) 177
Hpy188I TCNGA 1 cut(s) 105
Hpy188III TCNNGA 2 cut(s) 83, 174
Hpy99I CGWCG 2 cut(s) 109, 115
HpyAV CCTTC 1 cut(s) 183
HpyCH4III ACNGT 1 cut(s) 115
HpyCH4V TGCA 1 cut(s) 139
Hsp92I GRCGYC 1 cut(s) 107
Hsp92II CATG 1 cut(s) 233
Kzo9I GATC 1 cut(s) 38
LpnPI CCDG 5 cut(s) 9, 68, 125, 159, 229
Lsp1109I GCAGC 1 cut(s) 198
MalI GATC 1 cut(s) 40
MboI GATC 1 cut(s) 38
MboII GAAGA 1 cut(s) 198
MluCI AATT 1 cut(s) 8
MmeI TCCRAC 1 cut(s) 128
MnlI CCTC 3 cut(s) 39, 159, 162
MseI TTAA 1 cut(s) 150
NdeII GATC 1 cut(s) 38
NlaIII CATG 1 cut(s) 233
PfeI GAWTC 1 cut(s) 177
PkrI GCNGC 1 cut(s) 213
SaqAI TTAA 1 cut(s) 150
SatI GCNGC 1 cut(s) 212
Sau3AI GATC 1 cut(s) 38
SetI ASST 4 cut(s) 160, 173, 213, 239
SgeI CNNG 7 cut(s) 36, 54, 95, 142, 152, 186, 228
Sse9I AATT 1 cut(s) 8
SsiI CCGC 2 cut(s) 27, 66
TaaI ACNGT 1 cut(s) 115
TasI AATT 1 cut(s) 8
TfiI GAWTC 1 cut(s) 177
Tru1I TTAA 1 cut(s) 150
Tru9I TTAA 1 cut(s) 150
TseI GCWGC 1 cut(s) 211
XapI RAATTY 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.