Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001501.1

Orthogroup ID

OG0005435

Physical Location & Seq

Genomic Coordinates Forward (+)

193696 .. 194490

Gene Structure 795 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001501.1_g000043.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 795 bp

atgtcagtaatggacacgttctacatctcccatggatccccaaccttaagtattgacgagaccattcccgccggacatttcctccgatcctggaaacaaaacgggttcccccagaaacccaactccatcctcgtcatctccggccactgggaaacctccgtccccaccgtcaactccatcgccggcccacacgacaccatctacgacttctacggcttccccaaacccatgtacaagctcaagtaccccgcccccgggtccccccggctcgcctcccgcgtcaaggacctcctcaccgccgccgggttcccccgcgtcgacgtggacaccaagcgcggcctcgaccacggcgcgtgggtcccgctcatgttcatgtacccggaggcggatgttccggtgtgccagctgtccgtccagactaacagagacgggagctatcactacgacatggggaaggcgctggcgccgttgagggaggagggtgtccttattatggggtcggggagcgcgacgcataatctaagggcgctgaggaacacggacggggcggtggcgccgtgggcgttggagtttgatacttggcttaaggaggcgttgactcaaggaagatatgaagacgtgaaccattacgaggagaaagctccccatgcgaaaacggctcatccctggcctgaccatttctaccctcttcatgtggcaatgggggctgccggtgcgaattcgaaggccaagctcatccatgaaagctggcagcttggtactctttcttatgcttcataccagtttaccagttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00965 map00965

Pfam Domains

Protein Families

LigB

Protein Analysis

264

Amino Acids

29.35

Weight (kDa)

6.49

Isoelectric Point (pI)

37.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005435)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G15093
fragaria_vesca	FvH4_1g23880
malus_domestica	MD00G1165300.v1.1 MD15G1340700.v1.1
prunus_persica	Prupe.6G161400_v2.0.a1
pyrus_communis	pycom15g30030
rosa_chinensis	RchiOBHm_Chr2g0119801 RchiOBHm_Chr2g0119841 RchiOBHm_Chr6g0259111 RchiOBHm_Chr6g0259131
rosa_laevigata	RLG00000014556 RLG00000014558 RLG00000018494 RLG00000018495
rosa_multiflora	Rmu_sc0001501.1_g000043
rosa_roxburghii	Rroxscaffold_2G00124060
rosa_rugosa	Rorug02G0223900 Rorug02G0224100
rosa_samantha	Rh2AG281600 Rh2AG281900 Rh2BG293200 Rh2BG293300 Rh2DG288000 Rh2DG288200 Rh2DG307300 Rh6AG102000 Rh6BG094200 Rh6CG091400
rosa_wichuraiana	Rw2G022510

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	2 cut(s)	463, 553
AccBSI	CCGCTC	1 cut(s)	364
AccI	GTMKAC	1 cut(s)	318
AccII	CGCG	5 cut(s)	279, 315, 336, 353, 509
AclWI	GGATC	3 cut(s)	30, 43, 81
AcoI	YGGCCR	1 cut(s)	142
AcsI	RAATTY	1 cut(s)	718
AcyI	GRCGYC	2 cut(s)	464, 554
AfaI	GTAC	4 cut(s)	233, 245, 377, 760
AfiI	CCNNNNNNNGG	8 cut(s)	147, 254, 255, 283, 303, 385, 493, 631
AflII	CTTAAG	2 cut(s)	46, 584
AflIII	ACRYGT	1 cut(s)	15
AjiI	CACGTC	2 cut(s)	322, 619
AjnI	CCWGG	2 cut(s)	89, 665
AluBI	AGCT	7 cut(s)	238, 406, 435, 641, 733, 747, 754
AluI	AGCT	7 cut(s)	238, 406, 435, 641, 733, 747, 754
Alw26I	GTCTC	2 cut(s)	53, 420
AlwI	GGATC	3 cut(s)	30, 43, 81
Ama87I	CYCGRG	1 cut(s)	254
AoxI	GGCC	5 cut(s)	142, 184, 337, 668, 726
ApeKI	GCWGC	2 cut(s)	707, 751
ApoI	RAATTY	1 cut(s)	718
AspLEI	GCGC	7 cut(s)	336, 353, 460, 466, 509, 529, 556
AspS9I	GGNCC	4 cut(s)	185, 258, 286, 358
AsuC2I	CCSGG	5 cut(s)	255, 256, 265, 304, 380
AsuHPI	GGTGA	1 cut(s)	286
AsuII	TTCGAA	1 cut(s)	722
AvaI	CYCGRG	1 cut(s)	254
AvaII	GGWCC	3 cut(s)	258, 286, 358
BamHI	GGATCC	1 cut(s)	35
BanI	GGYRCC	2 cut(s)	463, 553
BbsI	GAAGAC	1 cut(s)	621
BbvCI	CCTCAGC	1 cut(s)	530
BbvI	GCAGC	2 cut(s)	694, 763
BccI	CCATC	3 cut(s)	134, 185, 206
BceAI	ACGGC	5 cut(s)	229, 364, 451, 541, 672
BciT130I	CCWGG	2 cut(s)	91, 667
BcnI	CCSGG	5 cut(s)	255, 256, 265, 304, 380
BcoDI	GTCTC	2 cut(s)	53, 420
BfoI	RGCGCY	4 cut(s)	461, 467, 530, 557
BfrI	CTTAAG	2 cut(s)	46, 584
BisI	GCNGC	4 cut(s)	300, 337, 708, 752
BlsI	GCNGC	4 cut(s)	301, 338, 709, 753
Bme1390I	CCNGG	7 cut(s)	91, 255, 256, 265, 304, 380, 667
Bme18I	GGWCC	3 cut(s)	258, 286, 358
BmeT110I	CYCGRG	1 cut(s)	254
BmgBI	CACGTC	2 cut(s)	322, 619
BmgT120I	GGNCC	4 cut(s)	185, 258, 286, 358
BmiI	GGNNCC	9 cut(s)	37, 107, 259, 260, 308, 359, 360, 465, 555
BmrFI	CCNGG	7 cut(s)	91, 255, 256, 265, 304, 380, 667
BmrI	ACTGGG	1 cut(s)	157
BmuI	ACTGGG	1 cut(s)	157
BpiI	GAAGAC	1 cut(s)	621
Bpu10I	CCTNAGC	1 cut(s)	530
Bpu14I	TTCGAA	1 cut(s)	722
BpuEI	CTTGAG	2 cut(s)	224, 585
BpuMI	CCSGG	5 cut(s)	255, 256, 265, 304, 380
BsaHI	GRCGYC	2 cut(s)	464, 554
BsaI	GGTCTC	1 cut(s)	53
BsaJI	CCNNGG	7 cut(s)	31, 253, 254, 263, 346, 557, 665
BsaWI	WCCGGW	1 cut(s)	394
BsaXI	ACNNNNNCTCC	2 cut(s)	66, 96
Bsc4I	CCNNNNNNNGG	8 cut(s)	147, 254, 255, 283, 303, 385, 493, 631
Bse118I	RCCGGY	2 cut(s)	182, 710
Bse1I	ACTGG	3 cut(s)	152, 781, 789
Bse3DI	GCAATG	1 cut(s)	705
BseBI	CCWGG	2 cut(s)	91, 667
BseDI	CCNNGG	7 cut(s)	31, 253, 254, 263, 346, 557, 665
BseGI	GGATG	4 cut(s)	126, 394, 661, 735
BseLI	CCNNNNNNNGG	8 cut(s)	147, 254, 255, 283, 303, 385, 493, 631
BseMI	GCAATG	1 cut(s)	705
BseMII	CTCAG	1 cut(s)	521
BseNI	ACTGG	3 cut(s)	152, 781, 789
BseRI	GAGGAG	3 cut(s)	281, 491, 647
BseXI	GCAGC	2 cut(s)	694, 763
Bsh1236I	CGCG	5 cut(s)	279, 315, 336, 353, 509
BshFI	GGCC	5 cut(s)	144, 186, 339, 670, 728
BshNI	GGYRCC	2 cut(s)	463, 553
BsiHKCI	CYCGRG	1 cut(s)	254
BsiSI	CCGG	9 cut(s)	72, 141, 183, 255, 265, 303, 380, 395, 711
BslFI	GGGAC	3 cut(s)	146, 244, 344
BslI	CCNNNNNNNGG	8 cut(s)	147, 254, 255, 283, 303, 385, 493, 631
BsmAI	GTCTC	2 cut(s)	53, 420
BsmBI	CGTCTC	1 cut(s)	420
BsmFI	GGGAC	3 cut(s)	146, 244, 344
BsnI	GGCC	5 cut(s)	144, 186, 339, 670, 728
Bso31I	GGTCTC	1 cut(s)	53
BsoBI	CYCGRG	1 cut(s)	254
Bsp119I	TTCGAA	1 cut(s)	722
Bsp1407I	TGTACA	1 cut(s)	231
Bsp143I	GATC	2 cut(s)	35, 86
Bsp19I	CCATGG	1 cut(s)	31
BspANI	GGCC	5 cut(s)	144, 186, 339, 670, 728
BspCNI	CTCAG	1 cut(s)	522
BspFNI	CGCG	5 cut(s)	279, 315, 336, 353, 509
BspLI	GGNNCC	9 cut(s)	37, 107, 259, 260, 308, 359, 360, 465, 555
BspPI	GGATC	3 cut(s)	30, 43, 81
BspT104I	TTCGAA	1 cut(s)	722
BspT107I	GGYRCC	2 cut(s)	463, 553
BspTI	CTTAAG	2 cut(s)	46, 584
BspTNI	GGTCTC	1 cut(s)	53
BsrBI	CCGCTC	1 cut(s)	364
BsrDI	GCAATG	1 cut(s)	705
BsrFI	RCCGGY	2 cut(s)	182, 710
BsrGI	TGTACA	1 cut(s)	231
BsrI	ACTGG	3 cut(s)	152, 781, 789
BssAI	RCCGGY	2 cut(s)	182, 710
BssECI	CCNNGG	7 cut(s)	31, 253, 254, 263, 346, 557, 665
BssMI	GATC	2 cut(s)	35, 86
BssNI	GRCGYC	2 cut(s)	464, 554
BssT1I	CCWWGG	1 cut(s)	31
Bst2UI	CCWGG	2 cut(s)	91, 667
Bst4CI	ACNGT	1 cut(s)	169
Bst6I	CTCTTC	1 cut(s)	693
BstACI	GRCGYC	2 cut(s)	464, 554
BstAFI	CTTAAG	2 cut(s)	46, 584
BstAUI	TGTACA	1 cut(s)	231
BstBI	TTCGAA	1 cut(s)	722
BstC8I	GCNNGC	5 cut(s)	184, 270, 404, 462, 749
BstDEI	CTNAG	2 cut(s)	521, 530
BstDSI	CCRYGG	3 cut(s)	31, 346, 557
BstF5I	GGATG	4 cut(s)	126, 394, 661, 735
BstFNI	CGCG	5 cut(s)	279, 315, 336, 353, 509
BstH2I	RGCGCY	4 cut(s)	461, 467, 530, 557
BstHHI	GCGC	7 cut(s)	336, 353, 460, 466, 509, 529, 556
BstKTI	GATC	2 cut(s)	38, 89
BstMAI	GTCTC	2 cut(s)	53, 420
BstMBI	GATC	2 cut(s)	35, 86
BstMWI	GCNNNNNNNGC	5 cut(s)	560, 647, 656, 704, 713
BstNI	CCWGG	2 cut(s)	91, 667
BstSCI	CCNGG	7 cut(s)	89, 253, 254, 263, 302, 378, 665
BstUI	CGCG	5 cut(s)	279, 315, 336, 353, 509
BstV1I	GCAGC	2 cut(s)	694, 763
BstV2I	GAAGAC	1 cut(s)	621
BstX2I	RGATCY	1 cut(s)	35
BstYI	RGATCY	1 cut(s)	35
BsuRI	GGCC	5 cut(s)	144, 186, 339, 670, 728
BtgI	CCRYGG	3 cut(s)	31, 346, 557
BtgZI	GCGATG	1 cut(s)	163
BtrI	CACGTC	2 cut(s)	322, 619
BtsCI	GGATG	4 cut(s)	126, 394, 661, 735
BtsIMutI	CAGTG	1 cut(s)	145
Cac8I	GCNNGC	5 cut(s)	184, 270, 404, 462, 749
CfoI	GCGC	7 cut(s)	336, 353, 460, 466, 509, 529, 556
Cfr10I	RCCGGY	2 cut(s)	182, 710
Cfr13I	GGNCC	4 cut(s)	185, 258, 286, 358
Cfr9I	CCCGGG	1 cut(s)	254
CseI	GACGC	3 cut(s)	268, 304, 520
Csp6I	GTAC	4 cut(s)	232, 244, 376, 759
CviAII	CATG	8 cut(s)	32, 229, 367, 373, 448, 647, 692, 740
CviQI	GTAC	4 cut(s)	232, 244, 376, 759
DdeI	CTNAG	2 cut(s)	521, 530
DinI	GGCGCC	2 cut(s)	465, 555
DpnI	GATC	2 cut(s)	37, 88
DpnII	GATC	2 cut(s)	35, 86
EaeI	YGGCCR	1 cut(s)	142
Eam1104I	CTCTTC	1 cut(s)	693
EarI	CTCTTC	1 cut(s)	693
EciI	GGCGGA	1 cut(s)	401
Eco130I	CCWWGG	1 cut(s)	31
Eco31I	GGTCTC	1 cut(s)	53
Eco47I	GGWCC	3 cut(s)	258, 286, 358
Eco88I	CYCGRG	1 cut(s)	254
EcoO109I	RGGNCCY	3 cut(s)	258, 286, 358
EcoRI	GAATTC	1 cut(s)	718
EcoRII	CCWGG	2 cut(s)	89, 665
EcoT14I	CCWWGG	1 cut(s)	31
EgeI	GGCGCC	2 cut(s)	465, 555
EheI	GGCGCC	2 cut(s)	465, 555
ErhI	CCWWGG	1 cut(s)	31
Esp3I	CGTCTC	1 cut(s)	420
FaeI	CATG	8 cut(s)	35, 232, 370, 376, 451, 650, 695, 743
FaqI	GGGAC	3 cut(s)	146, 244, 344
FatI	CATG	8 cut(s)	31, 228, 366, 372, 447, 646, 691, 739
FauI	CCCGC	5 cut(s)	76, 256, 284, 320, 369
FblI	GTMKAC	1 cut(s)	318
Fnu4HI	GCNGC	4 cut(s)	300, 337, 708, 752
FokI	GGATG	4 cut(s)	113, 401, 648, 722
Fsp4HI	GCNGC	4 cut(s)	300, 337, 708, 752
GlaI	GCGC	7 cut(s)	335, 352, 459, 465, 508, 528, 555
GluI	GCNGC	4 cut(s)	300, 337, 708, 752
HaeII	RGCGCY	4 cut(s)	461, 467, 530, 557
HaeIII	GGCC	5 cut(s)	144, 186, 339, 670, 728
HapII	CCGG	9 cut(s)	72, 141, 183, 255, 265, 303, 380, 395, 711
HgaI	GACGC	3 cut(s)	268, 304, 520
HhaI	GCGC	7 cut(s)	336, 353, 460, 466, 509, 529, 556
Hin1I	GRCGYC	2 cut(s)	464, 554
Hin1II	CATG	8 cut(s)	35, 232, 370, 376, 451, 650, 695, 743
Hin6I	GCGC	7 cut(s)	334, 351, 458, 464, 507, 527, 554
HinP1I	GCGC	7 cut(s)	334, 351, 458, 464, 507, 527, 554
HincII	GTYRAC	3 cut(s)	172, 319, 597
HindII	GTYRAC	3 cut(s)	172, 319, 597
HinfI	GANTC	1 cut(s)	598
HpaII	CCGG	9 cut(s)	72, 141, 183, 255, 265, 303, 380, 395, 711
HphI	GGTGA	1 cut(s)	286
Hpy166II	GTNNAC	6 cut(s)	172, 319, 325, 597, 622, 786
Hpy188I	TCNGA	1 cut(s)	86
Hpy188III	TCNNGA	1 cut(s)	415
Hpy8I	GTNNAC	6 cut(s)	172, 319, 325, 597, 622, 786
Hpy99I	CGWCG	3 cut(s)	320, 323, 514
HpyAV	CCTTC	2 cut(s)	448, 718
HpyCH4III	ACNGT	1 cut(s)	169
HpyCH4IV	ACGT	3 cut(s)	17, 321, 618
HpyF10VI	GCNNNNNNNGC	5 cut(s)	560, 647, 656, 704, 713
HpyF3I	CTNAG	2 cut(s)	521, 530
HpySE526I	ACGT	3 cut(s)	17, 321, 618
Hsp92I	GRCGYC	2 cut(s)	464, 554
Hsp92II	CATG	8 cut(s)	35, 232, 370, 376, 451, 650, 695, 743
HspAI	GCGC	7 cut(s)	334, 351, 458, 464, 507, 527, 554
KasI	GGCGCC	2 cut(s)	463, 553
KflI	GGGWCCC	2 cut(s)	258, 358
KroI	GCCGGC	1 cut(s)	182
KroNI	GCCGGC	1 cut(s)	184
Kzo9I	GATC	2 cut(s)	35, 86
LmnI	GCTCC	3 cut(s)	432, 504, 646
Lsp1109I	GCAGC	2 cut(s)	694, 763
MaeII	ACGT	3 cut(s)	17, 321, 618
MalI	GATC	2 cut(s)	37, 88
MbiI	CCGCTC	1 cut(s)	364
MboI	GATC	2 cut(s)	35, 86
MboII	GAAGA	3 cut(s)	618, 626, 680
MflI	RGATCY	1 cut(s)	35
MluCI	AATT	1 cut(s)	718
Mly113I	GGCGCC	2 cut(s)	464, 554
MlyI	GAGTC	1 cut(s)	592
MmeI	TCCRAC	1 cut(s)	546
MroNI	GCCGGC	1 cut(s)	182
MseI	TTAA	2 cut(s)	47, 585
MslI	CAYNNNNRTG	1 cut(s)	371
MspA1I	CMGCKG	1 cut(s)	406
MspCI	CTTAAG	2 cut(s)	46, 584
MspI	CCGG	9 cut(s)	72, 141, 183, 255, 265, 303, 380, 395, 711
MspR9I	CCNGG	7 cut(s)	91, 255, 256, 265, 304, 380, 667
MvaI	CCWGG	2 cut(s)	91, 667
MvnI	CGCG	5 cut(s)	279, 315, 336, 353, 509
MwoI	GCNNNNNNNGC	5 cut(s)	560, 647, 656, 704, 713
NaeI	GCCGGC	1 cut(s)	184
NarI	GGCGCC	2 cut(s)	464, 554
NciI	CCSGG	5 cut(s)	255, 256, 265, 304, 380
NcoI	CCATGG	1 cut(s)	31
NdeII	GATC	2 cut(s)	35, 86
NgoMIV	GCCGGC	1 cut(s)	182
NlaIII	CATG	8 cut(s)	35, 232, 370, 376, 451, 650, 695, 743
NlaIV	GGNNCC	9 cut(s)	37, 107, 259, 260, 308, 359, 360, 465, 555
NspV	TTCGAA	1 cut(s)	722
PcsI	WCGNNNNNNNCGW	2 cut(s)	276, 506
PdiI	GCCGGC	1 cut(s)	184
PfoI	TCCNGGA	1 cut(s)	89
PkrI	GCNGC	4 cut(s)	301, 338, 709, 753
PleI	GAGTC	1 cut(s)	592
PluTI	GGCGCC	2 cut(s)	467, 557
PpsI	GAGTC	1 cut(s)	592
PpuMI	RGGWCCY	3 cut(s)	258, 286, 358
Psp5II	RGGWCCY	3 cut(s)	258, 286, 358
Psp6I	CCWGG	2 cut(s)	89, 665
PspGI	CCWGG	2 cut(s)	89, 665
PspN4I	GGNNCC	9 cut(s)	37, 107, 259, 260, 308, 359, 360, 465, 555
PspPI	GGNCC	4 cut(s)	185, 258, 286, 358
PspPPI	RGGWCCY	3 cut(s)	258, 286, 358
PsuI	RGATCY	1 cut(s)	35
PvuII	CAGCTG	1 cut(s)	406
RsaI	GTAC	4 cut(s)	233, 245, 377, 760
RsaNI	GTAC	4 cut(s)	232, 244, 376, 759
RseI	CAYNNNNRTG	1 cut(s)	371
SalI	GTCGAC	1 cut(s)	317
SaqAI	TTAA	2 cut(s)	47, 585
SatI	GCNGC	4 cut(s)	300, 337, 708, 752
Sau3AI	GATC	2 cut(s)	35, 86
Sau96I	GGNCC	4 cut(s)	185, 258, 286, 358
SchI	GAGTC	1 cut(s)	592
ScrFI	CCNGG	7 cut(s)	91, 255, 256, 265, 304, 380, 667
SfoI	GGCGCC	2 cut(s)	465, 555
SfuI	TTCGAA	1 cut(s)	722
SgrDI	CGTCGACG	1 cut(s)	317
SinI	GGWCC	3 cut(s)	258, 286, 358
SmaI	CCCGGG	1 cut(s)	256
SmiMI	CAYNNNNRTG	1 cut(s)	371
SmlI	CTYRAG	4 cut(s)	46, 239, 584, 600
SmoI	CTYRAG	4 cut(s)	46, 239, 584, 600
Sse9I	AATT	1 cut(s)	718
SspDI	GGCGCC	2 cut(s)	463, 553
StyD4I	CCNGG	7 cut(s)	89, 253, 254, 263, 302, 378, 665
StyI	CCWWGG	1 cut(s)	31
TaaI	ACNGT	1 cut(s)	169
TaiI	ACGT	3 cut(s)	20, 324, 621
TaqI	TCGA	3 cut(s)	318, 342, 722
TasI	AATT	1 cut(s)	718
TatI	WGTACW	1 cut(s)	231
TauI	GCSGC	2 cut(s)	302, 339
Tru1I	TTAA	2 cut(s)	47, 585
Tru9I	TTAA	2 cut(s)	47, 585
TscAI	CASTG	1 cut(s)	152
TseI	GCWGC	2 cut(s)	707, 751
TspDTI	ATGAA	5 cut(s)	361, 627, 680, 756, 765
TspGWI	ACGGA	3 cut(s)	148, 400, 554
TspMI	CCCGGG	1 cut(s)	254
TspRI	CASTG	1 cut(s)	152
Vha464I	CTTAAG	2 cut(s)	46, 584
VpaK11BI	GGWCC	3 cut(s)	258, 286, 358
XapI	RAATTY	1 cut(s)	718
XmaI	CCCGGG	1 cut(s)	254
XmiI	GTMKAC	1 cut(s)	318

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.