Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001723.1

Orthogroup ID

OG0004031

Physical Location & Seq

Genomic Coordinates Forward (+)

19867 .. 20669

Gene Structure 803 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001723.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 261 bp

atgtggtatgacttcccctggactcccacaaaatatattccattttatggtggtgctgagtatcatgattaccatcattatgttggaggactaagccagagcaattttgcttcagttttcacctactgcgattacatttatgggactgacaagggatatcgttaccagaagaagatccttaaaaagttgaaagaggatactaatggtgtgcaaaatggagggtcgtacaacacctcaactgtagaccttaaaactgattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000254 GO:0003674 GO:0003824 GO:0004497 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0005789 GO:0006629 GO:0006694 GO:0008150 GO:0008152 GO:0008202 GO:0008610 GO:0009058 GO:0009987 GO:0012505 GO:0016020 GO:0016125 GO:0016126 GO:0016491 GO:0016705 GO:0016709 GO:0030258 GO:0031984 GO:0034440 GO:0042175 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044238 GO:0044255 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044444 GO:0044446 GO:0044464 GO:0055114 GO:0071704 GO:0080064 GO:0098827 GO:1901360 GO:1901362 GO:1901576 GO:1901615 GO:1901617

KEGG Pathways

Metabolic & Signaling

ko00100 ko01100 ko01110 map00100 map01100 map01110

Pfam Domains

Protein Families

FA_hydroxylase

Protein Analysis

86

Amino Acids

10.05

Weight (kDa)

6.81

Isoelectric Point (pI)

16.81

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004031)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G12110 AT4G22755 AT4G22756
fragaria_vesca	FvH4_5g00810 FvH4_7g11850
malus_domestica	MD04G1078200.v1.1 MD07G1008300.v1.1
prunus_persica	Prupe.2G145100_v2.0.a1 Prupe.5G080500_v2.0.a1
pyrus_communis	pycom04g07020 pycom06g06280
rosa_chinensis	RchiOBHm_Chr1g0350531 RchiOBHm_Chr7g0201301
rosa_laevigata	RLG00000003681 RLG00000028478
rosa_multiflora	Rmu_co8478905.1_g000001 Rmu_sc0001723.1_g000002 Rmu_ssc0000083.1_g000025 Rmu_ssc0000365.1_g000001
rosa_roxburghii	Rroxscaffold_3G00255370 Rroxscaffold_4G00304780
rosa_rugosa	Rorug01G0211700 Rorug07G0062500
rosa_samantha	Rh1AG226500 Rh1BG194900 Rh1CG211300 Rh1DG223100 Rh7AG189800 Rh7BG192300 Rh7CG200600 Rh7DG194700
rosa_wichuraiana	Rw1G019560 Rw7G016660

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	47
AccI	GTMKAC	1 cut(s)	243
AclWI	GGATC	1 cut(s)	169
AcuI	CTGAAG	1 cut(s)	96
AfaI	GTAC	1 cut(s)	227
AfiI	CCNNNNNNNGG	1 cut(s)	47
AgsI	TTSAA	1 cut(s)	190
AjnI	CCWGG	1 cut(s)	17
AlwI	GGATC	1 cut(s)	169
AsuHPI	GGTGA	1 cut(s)	112
BccI	CCATC	1 cut(s)	81
BciT130I	CCWGG	1 cut(s)	19
BciVI	GTATCC	1 cut(s)	190
BfmI	CTRYAG	1 cut(s)	240
BfuI	GTATCC	1 cut(s)	190
Bme1390I	CCNGG	1 cut(s)	19
BmrFI	CCNGG	1 cut(s)	19
BsaBI	GATNNNNATC	1 cut(s)	72
BsaJI	CCNNGG	1 cut(s)	17
Bsc4I	CCNNNNNNNGG	1 cut(s)	47
Bse8I	GATNNNNATC	1 cut(s)	72
BseBI	CCWGG	1 cut(s)	19
BseDI	CCNNGG	1 cut(s)	17
BseJI	GATNNNNATC	1 cut(s)	72
BseLI	CCNNNNNNNGG	1 cut(s)	47
BseMII	CTCAG	1 cut(s)	48
BslFI	GGGAC	1 cut(s)	157
BslI	CCNNNNNNNGG	1 cut(s)	47
BsmFI	GGGAC	1 cut(s)	157
Bsp143I	GATC	1 cut(s)	174
BspCNI	CTCAG	1 cut(s)	49
BspHI	TCATGA	1 cut(s)	64
BspPI	GGATC	1 cut(s)	169
BssECI	CCNNGG	1 cut(s)	17
BssMI	GATC	1 cut(s)	174
Bst2UI	CCWGG	1 cut(s)	19
Bst4CI	ACNGT	1 cut(s)	241
BstDEI	CTNAG	2 cut(s)	57, 92
BstKTI	GATC	1 cut(s)	177
BstMBI	GATC	1 cut(s)	174
BstNI	CCWGG	1 cut(s)	19
BstSCI	CCNGG	1 cut(s)	17
BstSFI	CTRYAG	1 cut(s)	240
BstX2I	RGATCY	1 cut(s)	174
BstYI	RGATCY	1 cut(s)	174
BsuI	GTATCC	1 cut(s)	190
CciI	TCATGA	1 cut(s)	64
Csp6I	GTAC	1 cut(s)	226
CviAII	CATG	1 cut(s)	65
CviJI	RGCY	1 cut(s)	96
CviKI_1	RGCY	1 cut(s)	96
CviQI	GTAC	1 cut(s)	226
DdeI	CTNAG	2 cut(s)	57, 92
DpnI	GATC	1 cut(s)	176
DpnII	GATC	1 cut(s)	174
Eco32I	GATATC	1 cut(s)	158
Eco57I	CTGAAG	1 cut(s)	96
EcoRII	CCWGG	1 cut(s)	17
EcoRV	GATATC	1 cut(s)	158
FaeI	CATG	1 cut(s)	68
FaiI	YATR	6 cut(s)	9, 36, 48, 66, 81, 141
FaqI	GGGAC	1 cut(s)	157
FatI	CATG	1 cut(s)	64
FblI	GTMKAC	1 cut(s)	243
Hin1II	CATG	1 cut(s)	68
HinfI	GANTC	1 cut(s)	22
HphI	GGTGA	1 cut(s)	112
Hpy166II	GTNNAC	1 cut(s)	244
Hpy188III	TCNNGA	1 cut(s)	65
Hpy8I	GTNNAC	1 cut(s)	244
HpyCH4III	ACNGT	1 cut(s)	241
HpyCH4V	TGCA	1 cut(s)	211
HpyF3I	CTNAG	2 cut(s)	57, 92
Hsp92II	CATG	1 cut(s)	68
Kzo9I	GATC	1 cut(s)	174
LpnPI	CCDG	4 cut(s)	4, 31, 110, 179
MaeIII	GTNAC	1 cut(s)	161
MalI	GATC	1 cut(s)	176
MboI	GATC	1 cut(s)	174
MboII	GAAGA	2 cut(s)	181, 184
MflI	RGATCY	1 cut(s)	174
MluCI	AATT	1 cut(s)	103
MlyI	GAGTC	1 cut(s)	16
MmeI	TCCRAC	1 cut(s)	64
MnlI	CCTC	4 cut(s)	80, 187, 212, 244
MseI	TTAA	2 cut(s)	180, 249
MslI	CAYNNNNRTG	1 cut(s)	78
MspR9I	CCNGG	1 cut(s)	19
MvaI	CCWGG	1 cut(s)	19
NdeII	GATC	1 cut(s)	174
NlaIII	CATG	1 cut(s)	68
PagI	TCATGA	1 cut(s)	64
PflMI	CCANNNNNTGG	1 cut(s)	47
PleI	GAGTC	1 cut(s)	16
PpsI	GAGTC	1 cut(s)	16
Psp6I	CCWGG	1 cut(s)	17
PspGI	CCWGG	1 cut(s)	17
PsuI	RGATCY	1 cut(s)	174
RsaI	GTAC	1 cut(s)	227
RsaNI	GTAC	1 cut(s)	226
RseI	CAYNNNNRTG	1 cut(s)	78
SaqAI	TTAA	2 cut(s)	180, 249
Sau3AI	GATC	1 cut(s)	174
SchI	GAGTC	1 cut(s)	16
ScrFI	CCNGG	1 cut(s)	19
SetI	ASST	3 cut(s)	125, 236, 249
SfcI	CTRYAG	1 cut(s)	240
SgeI	CNNG	6 cut(s)	30, 31, 77, 109, 163, 178
SmiMI	CAYNNNNRTG	1 cut(s)	78
Sse9I	AATT	1 cut(s)	103
StyD4I	CCNGG	1 cut(s)	17
TaaI	ACNGT	1 cut(s)	241
TasI	AATT	1 cut(s)	103
Tru1I	TTAA	2 cut(s)	180, 249
Tru9I	TTAA	2 cut(s)	180, 249
Van91I	CCANNNNNTGG	1 cut(s)	47
XcmI	CCANNNNNNNNNTGG	1 cut(s)	80
XmiI	GTMKAC	1 cut(s)	243

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.