Rmu_sc0001924.1_g000018

Domain of unknown function (DUF4408)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001924.1
OG0005407
Physical Location & Seq
Reverse (-)
83668 .. 84156
489 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001924.1_g000018.1.cds

Sequence Viewer

Length: 489 bp
atgatgagctcaatcttcttgagctccaaatttgtgttcatactaggcaacctcattgttgttgcccttgtaggagaatccaaaatcttttccacagtctcttctccacctaatattcatgttgaatatgaggaaagtatcaaaaggtgccaaaggtttcagccctcttcaacctacaaagagaacgaacctgaagaggtgaactctcttgttgaagaaagggtaatactgaagaactctcttattgaagaaagggtactgaagatgagctcttatggagatggagatggagatcaagctatagaaggaaaagggtataaggaacaaagtaaggaatcagtagtggaggaggtgaaagaggatatagatgacgaagatgaagagctcagtgtgcctgaggaccagcaattcaacaaaagagctgatgatttcattgcaagggtcaatgaaagaaggagatatgaactgctactttgtaatggtgaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4408

Protein Analysis

162

Amino Acids

18.56

Weight (kDa)

4.55

Isoelectric Point (pI)

70.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 147
AcsI RAATTY 1 cut(s) 29
AcuI CTGAAG 3 cut(s) 213, 251, 281
AfaI GTAC 1 cut(s) 258
AgsI TTSAA 5 cut(s) 125, 171, 215, 248, 412
AjuI GAANNNNNNNTTGG 2 cut(s) 20, 52
AluBI AGCT 6 cut(s) 9, 24, 270, 299, 385, 422
AluI AGCT 6 cut(s) 9, 24, 270, 299, 385, 422
Alw21I GWGCWC 4 cut(s) 11, 26, 272, 387
Alw26I GTCTC 1 cut(s) 103
ApoI RAATTY 1 cut(s) 29
AspS9I GGNCC 1 cut(s) 400
AsuHPI GGTGA 2 cut(s) 211, 364
AvaII GGWCC 1 cut(s) 400
AxyI CCTNAGG 1 cut(s) 396
BanI GGYRCC 1 cut(s) 147
BanII GRGCYC 4 cut(s) 11, 26, 272, 387
BarI GAAGNNNNNNTAC 2 cut(s) 240, 272
Bbv12I GWGCWC 4 cut(s) 11, 26, 272, 387
BccI CCATC 2 cut(s) 275, 281
BcoDI GTCTC 1 cut(s) 103
BfaI CTAG 1 cut(s) 44
BfmI CTRYAG 1 cut(s) 300
Bme18I GGWCC 1 cut(s) 400
BmgT120I GGNCC 1 cut(s) 400
BmiI GGNNCC 1 cut(s) 149
BplI GAGNNNNNCTC 2 cut(s) 188, 220
BpuEI CTTGAG 1 cut(s) 40
BsaBI GATNNNNATC 1 cut(s) 291
Bse21I CCTNAGG 1 cut(s) 396
Bse3DI GCAATG 1 cut(s) 432
Bse8I GATNNNNATC 1 cut(s) 291
BseJI GATNNNNATC 1 cut(s) 291
BseMI GCAATG 1 cut(s) 432
BseMII CTCAG 2 cut(s) 387, 400
BseRI GAGGAG 1 cut(s) 362
BshNI GGYRCC 1 cut(s) 147
BsiHKAI GWGCWC 4 cut(s) 11, 26, 272, 387
BsmAI GTCTC 1 cut(s) 103
Bsp1286I GDGCHC 4 cut(s) 11, 26, 272, 387
Bsp143I GATC 1 cut(s) 292
BspCNI CTCAG 2 cut(s) 388, 399
BspLI GGNNCC 1 cut(s) 149
BspQI GCTCTTC 1 cut(s) 375
BspT107I GGYRCC 1 cut(s) 147
BsrDI GCAATG 1 cut(s) 432
BssMI GATC 1 cut(s) 292
Bst4CI ACNGT 1 cut(s) 97
Bst6I CTCTTC 4 cut(s) 106, 172, 189, 375
BstDEI CTNAG 2 cut(s) 386, 396
BstKTI GATC 1 cut(s) 295
BstMAI GTCTC 1 cut(s) 103
BstMBI GATC 1 cut(s) 292
BstMWI GCNNNNNNNGC 1 cut(s) 391
BstSFI CTRYAG 1 cut(s) 300
Bsu36I CCTNAGG 1 cut(s) 396
BtsIMutI CAGTG 1 cut(s) 394
Cfr13I GGNCC 1 cut(s) 400
Csp6I GTAC 1 cut(s) 257
CviAII CATG 1 cut(s) 119
CviJI RGCY 7 cut(s) 9, 24, 163, 270, 299, 385, 422
CviKI_1 RGCY 7 cut(s) 9, 24, 163, 270, 299, 385, 422
CviQI GTAC 1 cut(s) 257
DdeI CTNAG 2 cut(s) 386, 396
DpnI GATC 1 cut(s) 294
DpnII GATC 1 cut(s) 292
Eam1104I CTCTTC 4 cut(s) 106, 172, 189, 375
EarI CTCTTC 4 cut(s) 106, 172, 189, 375
Ecl136II GAGCTC 4 cut(s) 9, 24, 270, 385
Eco24I GRGCYC 4 cut(s) 11, 26, 272, 387
Eco47I GGWCC 1 cut(s) 400
Eco53kI GAGCTC 4 cut(s) 9, 24, 270, 385
Eco57I CTGAAG 3 cut(s) 213, 251, 281
Eco81I CCTNAGG 1 cut(s) 396
EcoICRI GAGCTC 4 cut(s) 9, 24, 270, 385
EcoT38I GRGCYC 4 cut(s) 11, 26, 272, 387
FaeI CATG 1 cut(s) 122
FaiI YATR 8 cut(s) 41, 120, 129, 276, 302, 318, 365, 462
FatI CATG 1 cut(s) 118
FriOI GRGCYC 4 cut(s) 11, 26, 272, 387
FspBI CTAG 1 cut(s) 44
Hin1II CATG 1 cut(s) 122
HinfI GANTC 2 cut(s) 77, 335
HphI GGTGA 2 cut(s) 211, 364
Hpy166II GTNNAC 1 cut(s) 202
Hpy188III TCNNGA 1 cut(s) 19
Hpy8I GTNNAC 1 cut(s) 202
HpyAV CCTTC 2 cut(s) 299, 447
HpyCH4III ACNGT 1 cut(s) 97
HpyCH4V TGCA 1 cut(s) 437
HpyF10VI GCNNNNNNNGC 1 cut(s) 391
HpyF3I CTNAG 2 cut(s) 386, 396
Hsp92II CATG 1 cut(s) 122
Kzo9I GATC 1 cut(s) 292
LguI GCTCTTC 1 cut(s) 375
LmnI GCTCC 1 cut(s) 29
LpnPI CCDG 3 cut(s) 204, 408, 416
MaeI CTAG 1 cut(s) 44
MalI GATC 1 cut(s) 294
MboI GATC 1 cut(s) 292
MhlI GDGCHC 4 cut(s) 11, 26, 272, 387
MluCI AATT 2 cut(s) 29, 407
MnlI CCTC 8 cut(s) 62, 124, 175, 190, 340, 343, 352, 391
MwoI GCNNNNNNNGC 1 cut(s) 391
NdeII GATC 1 cut(s) 292
NlaIII CATG 1 cut(s) 122
NlaIV GGNNCC 1 cut(s) 149
PciSI GCTCTTC 1 cut(s) 375
PfeI GAWTC 2 cut(s) 77, 335
Psp124BI GAGCTC 4 cut(s) 11, 26, 272, 387
PspN4I GGNNCC 1 cut(s) 149
PspPI GGNCC 1 cut(s) 400
RsaI GTAC 1 cut(s) 258
RsaNI GTAC 1 cut(s) 257
SacI GAGCTC 4 cut(s) 11, 26, 272, 387
SapI GCTCTTC 1 cut(s) 375
Sau3AI GATC 1 cut(s) 292
Sau96I GGNCC 1 cut(s) 400
SduI GDGCHC 4 cut(s) 11, 26, 272, 387
SfcI CTRYAG 1 cut(s) 300
SinI GGWCC 1 cut(s) 400
SmlI CTYRAG 1 cut(s) 19
SmoI CTYRAG 1 cut(s) 19
Sse9I AATT 2 cut(s) 29, 407
SspI AATATT 1 cut(s) 115
SspMI CTAG 1 cut(s) 44
SstI GAGCTC 4 cut(s) 11, 26, 272, 387
TaaI ACNGT 1 cut(s) 97
TasI AATT 2 cut(s) 29, 407
TfiI GAWTC 2 cut(s) 77, 335
TscAI CASTG 1 cut(s) 394
TspDTI ATGAA 6 cut(s) 28, 107, 393, 421, 462, 477
TspRI CASTG 1 cut(s) 394
VpaK11BI GGWCC 1 cut(s) 400
XapI RAATTY 1 cut(s) 29
XspI CTAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.