Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001983.1

Orthogroup ID

OG0003510

Physical Location & Seq

Genomic Coordinates Forward (+)

62988 .. 64577

Gene Structure 1590 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001983.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1590 bp

atgttgaagaagccgccaagtaggaaccagagaaccaaaggaatcagggtgaagcatatattgcagattgcattgctgcttggggtatgcttttggttgatttatcagctcaagcattcctatgataagaaggcagcactggctgagaatgatcgaaaaacctctatcagaacccaaacggaaagtgagcttctgaaacttgggaggaaagaccttccaaacttggatgtgacagcacatgtgaaacgagatgaagatgaggaggaagaagctctaagagaggaagaagagaaacatgaagcagaagagcgagaagaagaggatccgaagcatgaggtagaagagatcgaagaagagggtcagaagcatgagggagaagagcaagaggaggaggaaaacaagaatgaagatcccgaagatgaaggaaaaggagcaggagatgaagagatagatgaaaatgatttggagacaaaagaagggggagattatcgtaatgagaaccttgtagatgaagagaaagaaagagaagatgggggtgatgagaaggatggtgacaggaatgaggatgaagaaagagaagaccgagaagaaaatgagaattcatcggatgatcaagataatgaaggaggtgatacgaatgctcatgaggcacgagaggaacattataagggggatgatgcttctagtgcagtgacccatgatacccaagttataagcactgaaactgagaaagaaagttcaaatgaaacctctgaaaccagtgaagatgaagatggaaaccaacacaatatgagattggtgcatggtgcaacatctgaaaatggcacttcaagtgtacctgcaagtgaagagaaacttgaagggaattcgtccaatcctgttgcaaactcacttttagatgcaaatgtgaaaatacaatctagtgaaccgccagaagcagaaaataactcaacaattgtgagttcagaagtaagcaacaacttagctgaagtcaaccaagaaactagtccgcagaataaaactgaaactatatctgagtcagctcagtctcagaatgcagcagtggatggtatggttactagagagggcagcacaggacaaactgtggtcgtggaacagactaataacacaatatctgtgaatgatcaattggattctaatgcaacagtttctagtcgtgaggtagagactaatgtgtcagaaaataccttaatatctgatggtacagctgcagtggaggatagctccagatcttcaacaataaaggagactaccagatcttcaacaataaaggagactacggatgccactgataatgaagagtcggcgaatgacgatgccactatgaatgatgagtcaaatgatcaagatgctactaagactgaagaatcgaatgatacaagtgaagatggtagggaaggtgaaggttcagactccacagataggacggaggatacagttcaggatgaccccattgattcttctgattcgcatatttccgaagatgagaaagaggctcggacagatttagatacattgccagaaatacaaacagagggagatgagaatggagaggctgcagcagaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

529

Amino Acids

58.53

Weight (kDa)

4.15

Isoelectric Point (pI)

55.94

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003510)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G33740 AT4G33740 AT4G33740 AT4G33740 AT4G33740
fragaria_vesca	FvH4_2g02971 FvH4_2g02971
malus_domestica	MD05G1108600.v1.1 MD10G1112600.v1.1
prunus_persica	Prupe.8G152300_v2.0.a1
pyrus_communis	pycom05g10460 pycom10g09740
rosa_chinensis	RchiOBHm_Chr1g0336871 RchiOBHm_Chr6g0247781
rosa_laevigata	RLG00000015180 RLG00000029328
rosa_multiflora	Rmu_sc0001983.1_g000010 Rmu_sc0004920.1_g000004 Rmu_sc0009569.1_g000009 Rmu_sc0018000.1_g000001
rosa_roxburghii	Rroxscaffold_180G00433250 Rroxscaffold_4G00315280 Rroxscaffold_7G00213660
rosa_rugosa	Rorug01G0128600 Rorug05G0528500
rosa_samantha	Rh1AG149300 Rh1BG117700 Rh1CG140500 Rh1DG156600 Rh6AG043600 Rh6BG038300 Rh6CG037100 Rh6DG034200
rosa_wichuraiana	Rw1G012080 Rw6G003780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	2 cut(s)	666, 713
AasI	GACNNNNNNGTC	1 cut(s)	1195
Acc36I	ACCTGC	1 cut(s)	847
AciI	CCGC	3 cut(s)	14, 929, 1010
AclWI	GGATC	3 cut(s)	317, 330, 404
AcsI	RAATTY	2 cut(s)	598, 865
AcuI	CTGAAG	2 cut(s)	1008, 1404
AfaI	GTAC	2 cut(s)	837, 1225
AfiI	CCNNNNNNNGG	1 cut(s)	1443
AflIII	ACRYGT	1 cut(s)	238
AgsI	TTSAA	6 cut(s)	7, 741, 831, 860, 1257, 1284
AhlI	ACTAGT	1 cut(s)	1004
AjuI	GAANNNNNNNTTGG	2 cut(s)	1133, 1165
AluBI	AGCT	7 cut(s)	109, 190, 272, 986, 1043, 1229, 1245
AluI	AGCT	7 cut(s)	109, 190, 272, 986, 1043, 1229, 1245
Alw26I	GTCTC	5 cut(s)	461, 1053, 1181, 1262, 1289
AlwI	GGATC	3 cut(s)	317, 330, 404
ApeKI	GCWGC	7 cut(s)	76, 134, 1058, 1089, 1229, 1577, 1580
ApoI	RAATTY	2 cut(s)	598, 865
AsuHPI	GGTGA	5 cut(s)	61, 548, 563, 641, 1433
BaeI	ACNNNNGTAYC	2 cut(s)	693, 726
BamHI	GGATCC	1 cut(s)	322
BauI	CACGAG	1 cut(s)	651
BbsI	GAAGAC	1 cut(s)	585
BbvI	GCAGC	6 cut(s)	63, 146, 1070, 1101, 1216, 1564
BccI	CCATC	6 cut(s)	524, 542, 767, 1061, 1214, 1403
BciVI	GTATCC	1 cut(s)	1447
BclI	TGATCA	3 cut(s)	610, 1144, 1363
BcoDI	GTCTC	5 cut(s)	461, 1053, 1181, 1262, 1289
BcuI	ACTAGT	1 cut(s)	1004
BfaI	CTAG	5 cut(s)	684, 921, 1005, 1080, 1173
BfmI	CTRYAG	2 cut(s)	1230, 1578
BfuAI	ACCTGC	1 cut(s)	847
BfuI	GTATCC	1 cut(s)	1447
BglII	AGATCT	2 cut(s)	1250, 1277
BisI	GCNGC	8 cut(s)	14, 77, 135, 1059, 1090, 1230, 1578, 1581
BlsI	GCNGC	8 cut(s)	15, 78, 136, 1060, 1091, 1231, 1579, 1582
BmiI	GGNNCC	2 cut(s)	26, 324
BmsI	GCATC	5 cut(s)	667, 889, 1294, 1327, 1360
BpiI	GAAGAC	1 cut(s)	585
BplI	GAGNNNNNCTC	2 cut(s)	1229, 1261
BpmI	CTGGAG	1 cut(s)	1231
BpuEI	CTTGAG	1 cut(s)	95
Bsc4I	CCNNNNNNNGG	1 cut(s)	1443
Bse1I	ACTGG	2 cut(s)	144, 759
Bse3DI	GCAATG	2 cut(s)	71, 1535
BseGI	GGATG	8 cut(s)	232, 553, 571, 613, 679, 1072, 1309, 1471
BseLI	CCNNNNNNNGG	1 cut(s)	1443
BseMI	GCAATG	2 cut(s)	71, 1535
BseMII	CTCAG	5 cut(s)	135, 717, 1026, 1058, 1064
BseNI	ACTGG	2 cut(s)	144, 759
BseRI	GAGGAG	3 cut(s)	275, 401, 404
BseXI	GCAGC	6 cut(s)	63, 146, 1070, 1101, 1216, 1564
BsgI	GTGCAG	1 cut(s)	708
BslI	CCNNNNNNNGG	1 cut(s)	1443
BsmAI	GTCTC	5 cut(s)	461, 1053, 1181, 1262, 1289
BsmI	GAATGC	3 cut(s)	115, 643, 1060
Bsp143I	GATC	9 cut(s)	151, 322, 345, 409, 610, 1144, 1250, 1277, 1363
BspACI	CCGC	3 cut(s)	14, 929, 1010
BspCNI	CTCAG	5 cut(s)	136, 718, 1027, 1057, 1063
BspHI	TCATGA	1 cut(s)	643
BspLI	GGNNCC	2 cut(s)	26, 324
BspMAI	CTGCAG	2 cut(s)	1234, 1582
BspMI	ACCTGC	1 cut(s)	847
BspPI	GGATC	3 cut(s)	317, 330, 404
BspQI	GCTCTTC	2 cut(s)	300, 372
BsrDI	GCAATG	2 cut(s)	71, 1535
BsrI	ACTGG	2 cut(s)	144, 759
BssMI	GATC	9 cut(s)	151, 322, 345, 409, 610, 1144, 1250, 1277, 1363
BssSI	CACGAG	1 cut(s)	651
Bst2BI	CACGAG	1 cut(s)	651
Bst4CI	ACNGT	3 cut(s)	1105, 1168, 1459
BstAPI	GCANNNNNTGC	1 cut(s)	61
BstDEI	CTNAG	8 cut(s)	144, 275, 726, 982, 1035, 1044, 1050, 1377
BstF5I	GGATG	8 cut(s)	232, 553, 571, 613, 679, 1072, 1309, 1471
BstKTI	GATC	9 cut(s)	154, 325, 348, 412, 613, 1147, 1253, 1280, 1366
BstMAI	GTCTC	5 cut(s)	461, 1053, 1181, 1262, 1289
BstMBI	GATC	9 cut(s)	151, 322, 345, 409, 610, 1144, 1250, 1277, 1363
BstMWI	GCNNNNNNNGC	4 cut(s)	61, 140, 647, 686
BstNSI	RCATGY	1 cut(s)	242
BstSFI	CTRYAG	2 cut(s)	1230, 1578
BstV1I	GCAGC	6 cut(s)	63, 146, 1070, 1101, 1216, 1564
BstV2I	GAAGAC	1 cut(s)	585
BstX2I	RGATCY	4 cut(s)	322, 409, 1250, 1277
BstYI	RGATCY	4 cut(s)	322, 409, 1250, 1277
BsuI	GTATCC	1 cut(s)	1447
BtsCI	GGATG	8 cut(s)	232, 553, 571, 613, 679, 1072, 1309, 1471
BtsI	GCAGTG	3 cut(s)	696, 1068, 1239
BtsIMutI	CAGTG	7 cut(s)	137, 696, 717, 766, 1068, 1239, 1308
BveI	ACCTGC	1 cut(s)	847
CciI	TCATGA	1 cut(s)	643
Csp6I	GTAC	2 cut(s)	836, 1224
CviAII	CATG	7 cut(s)	239, 296, 332, 368, 644, 698, 803
CviQI	GTAC	2 cut(s)	836, 1224
DdeI	CTNAG	8 cut(s)	144, 275, 726, 982, 1035, 1044, 1050, 1377
DpnI	GATC	9 cut(s)	153, 324, 347, 411, 612, 1146, 1252, 1279, 1365
DpnII	GATC	9 cut(s)	151, 322, 345, 409, 610, 1144, 1250, 1277, 1363
DrdI	GACNNNNNNGTC	1 cut(s)	1195
DseDI	GACNNNNNNGTC	1 cut(s)	1195
Eco57I	CTGAAG	2 cut(s)	1008, 1404
EcoRI	GAATTC	2 cut(s)	598, 865
FaeI	CATG	7 cut(s)	242, 299, 335, 371, 647, 701, 806
FalI	AAGNNNNNCTT	2 cut(s)	840, 872
FatI	CATG	7 cut(s)	238, 295, 331, 367, 643, 697, 802
FbaI	TGATCA	3 cut(s)	610, 1144, 1363
Fnu4HI	GCNGC	8 cut(s)	14, 77, 135, 1059, 1090, 1230, 1578, 1581
FokI	GGATG	8 cut(s)	239, 560, 578, 620, 686, 1079, 1316, 1478
Fsp4HI	GCNGC	8 cut(s)	14, 77, 135, 1059, 1090, 1230, 1578, 1581
FspBI	CTAG	5 cut(s)	684, 921, 1005, 1080, 1173
GluI	GCNGC	8 cut(s)	14, 77, 135, 1059, 1090, 1230, 1578, 1581
GsuI	CTGGAG	1 cut(s)	1231
Hin1II	CATG	7 cut(s)	242, 299, 335, 371, 647, 701, 806
HincII	GTYRAC	1 cut(s)	994
HindII	GTYRAC	1 cut(s)	994
HinfI	GANTC	9 cut(s)	42, 1037, 1154, 1322, 1355, 1388, 1433, 1478, 1487
HphI	GGTGA	5 cut(s)	61, 548, 563, 641, 1433
Hpy166II	GTNNAC	3 cut(s)	836, 926, 994
Hpy188III	TCNNGA	7 cut(s)	413, 614, 644, 1178, 1248, 1367, 1463
Hpy8I	GTNNAC	3 cut(s)	836, 926, 994
HpyAV	CCTTC	9 cut(s)	124, 224, 416, 470, 538, 617, 854, 1412, 1418
HpyCH4III	ACNGT	3 cut(s)	1105, 1168, 1459
HpyF10VI	GCNNNNNNNGC	4 cut(s)	61, 140, 647, 686
HpyF3I	CTNAG	8 cut(s)	144, 275, 726, 982, 1035, 1044, 1050, 1377
Hsp92II	CATG	7 cut(s)	242, 299, 335, 371, 647, 701, 806
Ksp22I	TGATCA	3 cut(s)	610, 1144, 1363
Kzo9I	GATC	9 cut(s)	151, 322, 345, 409, 610, 1144, 1250, 1277, 1363
LguI	GCTCTTC	2 cut(s)	300, 372
LmnI	GCTCC	2 cut(s)	431, 1250
Lsp1109I	GCAGC	6 cut(s)	63, 146, 1070, 1101, 1216, 1564
LweI	GCATC	5 cut(s)	667, 889, 1294, 1327, 1360
MaeI	CTAG	5 cut(s)	684, 921, 1005, 1080, 1173
MaeIII	GTNAC	4 cut(s)	229, 551, 691, 1075
MalI	GATC	9 cut(s)	153, 324, 347, 411, 612, 1146, 1252, 1279, 1365
MboI	GATC	9 cut(s)	151, 322, 345, 409, 610, 1144, 1250, 1277, 1363
MfeI	CAATTG	2 cut(s)	954, 1148
MflI	RGATCY	4 cut(s)	322, 409, 1250, 1277
MluCI	AATT	4 cut(s)	598, 865, 954, 1148
MlyI	GAGTC	4 cut(s)	1046, 1331, 1364, 1427
MseI	TTAA	1 cut(s)	1211
MslI	CAYNNNNRTG	1 cut(s)	120
MspA1I	CMGCKG	1 cut(s)	1229
MunI	CAATTG	2 cut(s)	954, 1148
Mva1269I	GAATGC	3 cut(s)	115, 643, 1060
MwoI	GCNNNNNNNGC	4 cut(s)	61, 140, 647, 686
NdeII	GATC	9 cut(s)	151, 322, 345, 409, 610, 1144, 1250, 1277, 1363
NlaIII	CATG	7 cut(s)	242, 299, 335, 371, 647, 701, 806
NlaIV	GGNNCC	2 cut(s)	26, 324
NmuCI	GTSAC	3 cut(s)	229, 551, 691
NspI	RCATGY	1 cut(s)	242
PagI	TCATGA	1 cut(s)	643
PciI	ACATGT	1 cut(s)	238
PciSI	GCTCTTC	2 cut(s)	300, 372
PctI	GAATGC	3 cut(s)	115, 643, 1060
PfeI	GAWTC	5 cut(s)	42, 1154, 1388, 1478, 1487
PkrI	GCNGC	8 cut(s)	15, 78, 136, 1060, 1091, 1231, 1579, 1582
PleI	GAGTC	4 cut(s)	1045, 1330, 1363, 1427
PpsI	GAGTC	4 cut(s)	1045, 1330, 1363, 1427
PscI	ACATGT	1 cut(s)	238
PsiI	TTATAA	2 cut(s)	666, 713
PspN4I	GGNNCC	2 cut(s)	26, 324
PstI	CTGCAG	2 cut(s)	1234, 1582
PsuI	RGATCY	4 cut(s)	322, 409, 1250, 1277
PvuII	CAGCTG	1 cut(s)	1229
RsaI	GTAC	2 cut(s)	837, 1225
RsaNI	GTAC	2 cut(s)	836, 1224
RseI	CAYNNNNRTG	1 cut(s)	120
SapI	GCTCTTC	2 cut(s)	300, 372
SaqAI	TTAA	1 cut(s)	1211
SatI	GCNGC	8 cut(s)	14, 77, 135, 1059, 1090, 1230, 1578, 1581
Sau3AI	GATC	9 cut(s)	151, 322, 345, 409, 610, 1144, 1250, 1277, 1363
SchI	GAGTC	4 cut(s)	1046, 1331, 1364, 1427
SfaNI	GCATC	5 cut(s)	667, 889, 1294, 1327, 1360
SfcI	CTRYAG	2 cut(s)	1230, 1578
SmiMI	CAYNNNNRTG	1 cut(s)	120
SmlI	CTYRAG	1 cut(s)	110
SmoI	CTYRAG	1 cut(s)	110
SpeI	ACTAGT	1 cut(s)	1004
Sse9I	AATT	4 cut(s)	598, 865, 954, 1148
SsiI	CCGC	3 cut(s)	14, 929, 1010
SspMI	CTAG	5 cut(s)	684, 921, 1005, 1080, 1173
TaaI	ACNGT	3 cut(s)	1105, 1168, 1459
TaqI	TCGA	3 cut(s)	154, 348, 1391
TaqII	GACCGA	1 cut(s)	597
TasI	AATT	4 cut(s)	598, 865, 954, 1148
TauI	GCSGC	1 cut(s)	16
TfiI	GAWTC	5 cut(s)	42, 1154, 1388, 1478, 1487
Tru1I	TTAA	1 cut(s)	1211
Tru9I	TTAA	1 cut(s)	1211
TscAI	CASTG	7 cut(s)	144, 696, 724, 766, 1068, 1239, 1315
TseFI	GTSAC	3 cut(s)	229, 551, 691
TseI	GCWGC	7 cut(s)	76, 134, 1058, 1089, 1229, 1577, 1580
Tsp45I	GTSAC	3 cut(s)	229, 551, 691
TspGWI	ACGGA	3 cut(s)	194, 1316, 1463
TspRI	CASTG	7 cut(s)	144, 696, 724, 766, 1068, 1239, 1315
XapI	RAATTY	2 cut(s)	598, 865
XceI	RCATGY	1 cut(s)	242
XspI	CTAG	5 cut(s)	684, 921, 1005, 1080, 1173

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.