Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0018000.1

Orthogroup ID

OG0003510

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 715

Gene Structure 715 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0018000.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 715 bp

tcctgttgcaaactcacttttagatgcaaatgtgaaaatacaatctagtgaaccgccagaagcagaaaataactcaacaattgtgagttcagaagtaagcaacaacttagctgaagtcaaccaagaaactagtccgcagaataaaactgaaactatatctgagtcagctcagtctcagaatgcagcagtggatggtatggttactagagagggcagcacaggacaaactgtggtcgtggaacagactaataacacaatatctgtgaatgatcaattggattctaatgcaacagtttctagtcgtgaggtagagactaatgtgtcagaaaataccttaatatctgatggtacagctgcagtggaggatagctccagatcttcaacaataaaggagactaccagatcttcaacaataaaggagactacggatgccactgataatgaagagtcggcgaatgacgatgccactatgaatgatgagtcaaatgatcaagatgctactaagactgaagaatcgaatgatacaagtgaagatggtagggaaggtgaaggttcagactccacagataggacggaggatacagttcaggatgaccccattgattcttctgattcgcatatttccgaagatgagaaagaggctcggacagatttagatacattgccagaaatacaaacagagggagatgagaatggagaggctgcagcagaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

237

Amino Acids

25.22

Weight (kDa)

4.05

Isoelectric Point (pI)

52.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003510)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G33740 AT4G33740 AT4G33740 AT4G33740 AT4G33740
fragaria_vesca	FvH4_2g02971 FvH4_2g02971
malus_domestica	MD05G1108600.v1.1 MD10G1112600.v1.1
prunus_persica	Prupe.8G152300_v2.0.a1
pyrus_communis	pycom05g10460 pycom10g09740
rosa_chinensis	RchiOBHm_Chr1g0336871 RchiOBHm_Chr6g0247781
rosa_laevigata	RLG00000015180 RLG00000029328
rosa_multiflora	Rmu_sc0001983.1_g000010 Rmu_sc0004920.1_g000004 Rmu_sc0009569.1_g000009 Rmu_sc0018000.1_g000001
rosa_roxburghii	Rroxscaffold_180G00433250 Rroxscaffold_4G00315280 Rroxscaffold_7G00213660
rosa_rugosa	Rorug01G0128600 Rorug05G0528500
rosa_samantha	Rh1AG149300 Rh1BG117700 Rh1CG140500 Rh1DG156600 Rh6AG043600 Rh6BG038300 Rh6CG037100 Rh6DG034200
rosa_wichuraiana	Rw1G012080 Rw6G003780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	320
AciI	CCGC	2 cut(s)	54, 135
AcuI	CTGAAG	2 cut(s)	133, 529
AfaI	GTAC	1 cut(s)	350
AfiI	CCNNNNNNNGG	1 cut(s)	568
AgsI	TTSAA	2 cut(s)	382, 409
AhlI	ACTAGT	1 cut(s)	129
AjuI	GAANNNNNNNTTGG	2 cut(s)	258, 290
AluBI	AGCT	4 cut(s)	111, 168, 354, 370
AluI	AGCT	4 cut(s)	111, 168, 354, 370
Alw26I	GTCTC	4 cut(s)	178, 306, 387, 414
ApeKI	GCWGC	5 cut(s)	183, 214, 354, 702, 705
AsuHPI	GGTGA	1 cut(s)	558
BbvI	GCAGC	4 cut(s)	195, 226, 341, 689
BccI	CCATC	3 cut(s)	186, 339, 528
BciVI	GTATCC	1 cut(s)	572
BclI	TGATCA	2 cut(s)	269, 488
BcoDI	GTCTC	4 cut(s)	178, 306, 387, 414
BcuI	ACTAGT	1 cut(s)	129
BfaI	CTAG	4 cut(s)	46, 130, 205, 298
BfmI	CTRYAG	2 cut(s)	355, 703
BfuI	GTATCC	1 cut(s)	572
BglII	AGATCT	2 cut(s)	375, 402
BisI	GCNGC	5 cut(s)	184, 215, 355, 703, 706
BlsI	GCNGC	5 cut(s)	185, 216, 356, 704, 707
BmsI	GCATC	4 cut(s)	14, 419, 452, 485
BplI	GAGNNNNNCTC	2 cut(s)	354, 386
BpmI	CTGGAG	1 cut(s)	356
Bsc4I	CCNNNNNNNGG	1 cut(s)	568
Bse3DI	GCAATG	1 cut(s)	660
BseGI	GGATG	3 cut(s)	197, 434, 596
BseLI	CCNNNNNNNGG	1 cut(s)	568
BseMI	GCAATG	1 cut(s)	660
BseMII	CTCAG	3 cut(s)	151, 183, 189
BseXI	GCAGC	4 cut(s)	195, 226, 341, 689
BslI	CCNNNNNNNGG	1 cut(s)	568
BsmAI	GTCTC	4 cut(s)	178, 306, 387, 414
BsmI	GAATGC	1 cut(s)	185
Bsp143I	GATC	4 cut(s)	269, 375, 402, 488
BspACI	CCGC	2 cut(s)	54, 135
BspCNI	CTCAG	3 cut(s)	152, 182, 188
BspMAI	CTGCAG	2 cut(s)	359, 707
BsrDI	GCAATG	1 cut(s)	660
BssMI	GATC	4 cut(s)	269, 375, 402, 488
Bst4CI	ACNGT	3 cut(s)	230, 293, 584
Bst6I	CTCTTC	1 cut(s)	439
BstDEI	CTNAG	5 cut(s)	107, 160, 169, 175, 502
BstF5I	GGATG	3 cut(s)	197, 434, 596
BstKTI	GATC	4 cut(s)	272, 378, 405, 491
BstMAI	GTCTC	4 cut(s)	178, 306, 387, 414
BstMBI	GATC	4 cut(s)	269, 375, 402, 488
BstSFI	CTRYAG	2 cut(s)	355, 703
BstV1I	GCAGC	4 cut(s)	195, 226, 341, 689
BstX2I	RGATCY	2 cut(s)	375, 402
BstYI	RGATCY	2 cut(s)	375, 402
BsuI	GTATCC	1 cut(s)	572
BtsCI	GGATG	3 cut(s)	197, 434, 596
BtsI	GCAGTG	2 cut(s)	193, 364
BtsIMutI	CAGTG	3 cut(s)	193, 364, 433
Csp6I	GTAC	1 cut(s)	349
CviJI	RGCY	6 cut(s)	111, 168, 354, 370, 642, 702
CviKI_1	RGCY	6 cut(s)	111, 168, 354, 370, 642, 702
CviQI	GTAC	1 cut(s)	349
DdeI	CTNAG	5 cut(s)	107, 160, 169, 175, 502
DpnI	GATC	4 cut(s)	271, 377, 404, 490
DpnII	GATC	4 cut(s)	269, 375, 402, 488
DrdI	GACNNNNNNGTC	1 cut(s)	320
DseDI	GACNNNNNNGTC	1 cut(s)	320
Eam1104I	CTCTTC	1 cut(s)	439
EarI	CTCTTC	1 cut(s)	439
Eco57I	CTGAAG	2 cut(s)	133, 529
FaiI	YATR	4 cut(s)	156, 198, 471, 619
FbaI	TGATCA	2 cut(s)	269, 488
Fnu4HI	GCNGC	5 cut(s)	184, 215, 355, 703, 706
FokI	GGATG	3 cut(s)	204, 441, 603
Fsp4HI	GCNGC	5 cut(s)	184, 215, 355, 703, 706
FspBI	CTAG	4 cut(s)	46, 130, 205, 298
GluI	GCNGC	5 cut(s)	184, 215, 355, 703, 706
GsuI	CTGGAG	1 cut(s)	356
HincII	GTYRAC	1 cut(s)	119
HindII	GTYRAC	1 cut(s)	119
HinfI	GANTC	8 cut(s)	162, 279, 447, 480, 513, 558, 603, 612
HphI	GGTGA	1 cut(s)	558
Hpy166II	GTNNAC	2 cut(s)	51, 119
Hpy188I	TCNGA	9 cut(s)	92, 161, 178, 326, 344, 557, 611, 626, 646
Hpy188III	TCNNGA	4 cut(s)	303, 373, 492, 588
Hpy8I	GTNNAC	2 cut(s)	51, 119
HpyAV	CCTTC	2 cut(s)	537, 543
HpyCH4III	ACNGT	3 cut(s)	230, 293, 584
HpyCH4V	TGCA	6 cut(s)	9, 27, 183, 288, 357, 705
HpyF3I	CTNAG	5 cut(s)	107, 160, 169, 175, 502
Ksp22I	TGATCA	2 cut(s)	269, 488
Kzo9I	GATC	4 cut(s)	269, 375, 402, 488
LmnI	GCTCC	1 cut(s)	375
LpnPI	CCDG	7 cut(s)	16, 70, 205, 386, 413, 573, 679
Lsp1109I	GCAGC	4 cut(s)	195, 226, 341, 689
LweI	GCATC	4 cut(s)	14, 419, 452, 485
MaeI	CTAG	4 cut(s)	46, 130, 205, 298
MaeIII	GTNAC	1 cut(s)	200
MalI	GATC	4 cut(s)	271, 377, 404, 490
MboI	GATC	4 cut(s)	269, 375, 402, 488
MboII	GAAGA	7 cut(s)	370, 397, 456, 522, 543, 598, 639
MfeI	CAATTG	2 cut(s)	79, 273
MflI	RGATCY	2 cut(s)	375, 402
MluCI	AATT	2 cut(s)	79, 273
MlyI	GAGTC	4 cut(s)	171, 456, 489, 552
MnlI	CCTC	7 cut(s)	203, 299, 356, 569, 632, 674, 692
MseI	TTAA	1 cut(s)	336
MspA1I	CMGCKG	1 cut(s)	354
MunI	CAATTG	2 cut(s)	79, 273
Mva1269I	GAATGC	1 cut(s)	185
NdeII	GATC	4 cut(s)	269, 375, 402, 488
PctI	GAATGC	1 cut(s)	185
PfeI	GAWTC	4 cut(s)	279, 513, 603, 612
PkrI	GCNGC	5 cut(s)	185, 216, 356, 704, 707
PleI	GAGTC	4 cut(s)	170, 455, 488, 552
PpsI	GAGTC	4 cut(s)	170, 455, 488, 552
PstI	CTGCAG	2 cut(s)	359, 707
PsuI	RGATCY	2 cut(s)	375, 402
PvuII	CAGCTG	1 cut(s)	354
RsaI	GTAC	1 cut(s)	350
RsaNI	GTAC	1 cut(s)	349
SaqAI	TTAA	1 cut(s)	336
SatI	GCNGC	5 cut(s)	184, 215, 355, 703, 706
Sau3AI	GATC	4 cut(s)	269, 375, 402, 488
SchI	GAGTC	4 cut(s)	171, 456, 489, 552
SetI	ASST	8 cut(s)	113, 170, 310, 336, 356, 372, 548, 554
SfaNI	GCATC	4 cut(s)	14, 419, 452, 485
SfcI	CTRYAG	2 cut(s)	355, 703
SpeI	ACTAGT	1 cut(s)	129
Sse9I	AATT	2 cut(s)	79, 273
SsiI	CCGC	2 cut(s)	54, 135
SspMI	CTAG	4 cut(s)	46, 130, 205, 298
TaaI	ACNGT	3 cut(s)	230, 293, 584
TaqI	TCGA	1 cut(s)	516
TasI	AATT	2 cut(s)	79, 273
TfiI	GAWTC	4 cut(s)	279, 513, 603, 612
Tru1I	TTAA	1 cut(s)	336
Tru9I	TTAA	1 cut(s)	336
TscAI	CASTG	3 cut(s)	193, 364, 440
TseI	GCWGC	5 cut(s)	183, 214, 354, 702, 705
TspDTI	ATGAA	2 cut(s)	457, 486
TspGWI	ACGGA	2 cut(s)	441, 588
TspRI	CASTG	3 cut(s)	193, 364, 440
XspI	CTAG	4 cut(s)	46, 130, 205, 298

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.