Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009569.1

Orthogroup ID

OG0003510

Physical Location & Seq

Genomic Coordinates Forward (+)

37418 .. 39028

Gene Structure 1611 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009569.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1611 bp

atgttgaagaagccgccaagtaggaaccagagaaccaaaggaatcagggtgaagcatatattgcagattgcattgctgcttggggtatgcttttggttgatttatcagctcaagcattcctatgataagaaggcagcactggctgagaatgatcgaaaaacctctatcagaacccaaacggaaagtgagcttctgaaacttgggaggaaagaccttccaaacttggatgtgacagcacatgtgaaacgatatgaagatgaggaggaagaagctctaagagaggaagaagagaaacatgaggtagaagatgagaaacatgaagcagaagagcgagaagaagaggatccgaagcatgaggtagaagagatcgaagaagagggtcagaagcatgagggagaagagcaagaggaggaggaaaacaagaatgaagatcccgaagatgaaggaaaaggagcaggagatgaagagatagatgaaaatgatttggagacaaaagaagggggagattatcgtaatgagaaccttgtagatgaagagaaagaaagagaagatgggggtgatgagaaggatggtgacaggaatgaggatgaagaaagagaagaccgagaagaaaatgagaattcatcggatgatcaagataatgaaggaggtgatacgaatgctcatgaggcacgagaggaacattataagggggatgatgcttctagtgcagtgacccatgatacccaagttataagcactgaaactgagaaagaaagttcaaatgaaacctctgaaaccagtgaagatgaagatggaaaccaacacaatatgagattggtgcatggtgcaacatctgaaaatggcacttcaagtgtacctgcaagtgaagagaaacttgaagggaattcgtccaatcctgttgcaaactcacttttagatgcaaatgtgaaaatacaatctagtgaaccgccagaagcagaaaataactcaacaatagtgagttcagaagtaagcaacaacttagctgaagtcaaccaagaaactagtccgcagaatacaactgaaactatatctgagtcagctcagtctcagaatgcagcagtggatggtatggttactagagagggcagcacaggacaaactgtggtcgtggaacagactaataacacaatatctgtgaatgatcaattggattctaatgcaacagtttctagtcgtgaggtagagactaatgtgtcagaaaataccttaatatctgatggtacagctgcagtggaggatagctccagatcttcaacaataaaggagactaccagatcttcaacaataaaggagactacggatgccactgataatgaagagtcggcgaatgacgatgccactatgaatgatgagtcaaatgatcaagatgctactaagactgaagaatcgaatgatacaagtgaagatggtagggaaggtgaaggttcagactccacagataggacggaggatacagttcaggatgaccccattgattcttctgattcgcatatttccgaagatgagaaagaggctcggacagatttagatacattgccagaaatacaaacagagggagatgagaatggagaggctgcagcagaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

536

Amino Acids

59.42

Weight (kDa)

4.14

Isoelectric Point (pI)

54.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003510)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G33740 AT4G33740 AT4G33740 AT4G33740 AT4G33740
fragaria_vesca	FvH4_2g02971 FvH4_2g02971
malus_domestica	MD05G1108600.v1.1 MD10G1112600.v1.1
prunus_persica	Prupe.8G152300_v2.0.a1
pyrus_communis	pycom05g10460 pycom10g09740
rosa_chinensis	RchiOBHm_Chr1g0336871 RchiOBHm_Chr6g0247781
rosa_laevigata	RLG00000015180 RLG00000029328
rosa_multiflora	Rmu_sc0001983.1_g000010 Rmu_sc0004920.1_g000004 Rmu_sc0009569.1_g000009 Rmu_sc0018000.1_g000001
rosa_roxburghii	Rroxscaffold_180G00433250 Rroxscaffold_4G00315280 Rroxscaffold_7G00213660
rosa_rugosa	Rorug01G0128600 Rorug05G0528500
rosa_samantha	Rh1AG149300 Rh1BG117700 Rh1CG140500 Rh1DG156600 Rh6AG043600 Rh6BG038300 Rh6CG037100 Rh6DG034200
rosa_wichuraiana	Rw1G012080 Rw6G003780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	2 cut(s)	687, 734
AasI	GACNNNNNNGTC	1 cut(s)	1216
Acc36I	ACCTGC	1 cut(s)	868
AciI	CCGC	3 cut(s)	14, 950, 1031
AclWI	GGATC	3 cut(s)	338, 351, 425
AcsI	RAATTY	2 cut(s)	619, 886
AcuI	CTGAAG	2 cut(s)	1029, 1425
AfaI	GTAC	2 cut(s)	858, 1246
AfiI	CCNNNNNNNGG	1 cut(s)	1464
AflIII	ACRYGT	1 cut(s)	238
AgsI	TTSAA	6 cut(s)	7, 762, 852, 881, 1278, 1305
AhlI	ACTAGT	1 cut(s)	1025
AjuI	GAANNNNNNNTTGG	2 cut(s)	1154, 1186
AluBI	AGCT	7 cut(s)	109, 190, 272, 1007, 1064, 1250, 1266
AluI	AGCT	7 cut(s)	109, 190, 272, 1007, 1064, 1250, 1266
Alw26I	GTCTC	5 cut(s)	482, 1074, 1202, 1283, 1310
AlwI	GGATC	3 cut(s)	338, 351, 425
ApeKI	GCWGC	7 cut(s)	76, 134, 1079, 1110, 1250, 1598, 1601
ApoI	RAATTY	2 cut(s)	619, 886
AsuHPI	GGTGA	5 cut(s)	61, 569, 584, 662, 1454
BaeI	ACNNNNGTAYC	2 cut(s)	714, 747
BamHI	GGATCC	1 cut(s)	343
BauI	CACGAG	1 cut(s)	672
BbsI	GAAGAC	1 cut(s)	606
BbvI	GCAGC	6 cut(s)	63, 146, 1091, 1122, 1237, 1585
BccI	CCATC	6 cut(s)	545, 563, 788, 1082, 1235, 1424
BciVI	GTATCC	1 cut(s)	1468
BclI	TGATCA	3 cut(s)	631, 1165, 1384
BcoDI	GTCTC	5 cut(s)	482, 1074, 1202, 1283, 1310
BcuI	ACTAGT	1 cut(s)	1025
BfaI	CTAG	5 cut(s)	705, 942, 1026, 1101, 1194
BfmI	CTRYAG	2 cut(s)	1251, 1599
BfuAI	ACCTGC	1 cut(s)	868
BfuI	GTATCC	1 cut(s)	1468
BglII	AGATCT	2 cut(s)	1271, 1298
BisI	GCNGC	8 cut(s)	14, 77, 135, 1080, 1111, 1251, 1599, 1602
BlsI	GCNGC	8 cut(s)	15, 78, 136, 1081, 1112, 1252, 1600, 1603
BmiI	GGNNCC	2 cut(s)	26, 345
BmsI	GCATC	5 cut(s)	688, 910, 1315, 1348, 1381
BpiI	GAAGAC	1 cut(s)	606
BplI	GAGNNNNNCTC	2 cut(s)	1250, 1282
BpmI	CTGGAG	1 cut(s)	1252
BpuEI	CTTGAG	1 cut(s)	95
Bsc4I	CCNNNNNNNGG	1 cut(s)	1464
Bse1I	ACTGG	2 cut(s)	144, 780
Bse3DI	GCAATG	2 cut(s)	71, 1556
BseGI	GGATG	8 cut(s)	232, 574, 592, 634, 700, 1093, 1330, 1492
BseLI	CCNNNNNNNGG	1 cut(s)	1464
BseMI	GCAATG	2 cut(s)	71, 1556
BseMII	CTCAG	5 cut(s)	135, 738, 1047, 1079, 1085
BseNI	ACTGG	2 cut(s)	144, 780
BseRI	GAGGAG	3 cut(s)	275, 422, 425
BseXI	GCAGC	6 cut(s)	63, 146, 1091, 1122, 1237, 1585
BsgI	GTGCAG	1 cut(s)	729
BslI	CCNNNNNNNGG	1 cut(s)	1464
BsmAI	GTCTC	5 cut(s)	482, 1074, 1202, 1283, 1310
BsmI	GAATGC	3 cut(s)	115, 664, 1081
Bsp143I	GATC	9 cut(s)	151, 343, 366, 430, 631, 1165, 1271, 1298, 1384
BspACI	CCGC	3 cut(s)	14, 950, 1031
BspCNI	CTCAG	5 cut(s)	136, 739, 1048, 1078, 1084
BspHI	TCATGA	1 cut(s)	664
BspLI	GGNNCC	2 cut(s)	26, 345
BspMAI	CTGCAG	2 cut(s)	1255, 1603
BspMI	ACCTGC	1 cut(s)	868
BspPI	GGATC	3 cut(s)	338, 351, 425
BspQI	GCTCTTC	2 cut(s)	321, 393
BsrDI	GCAATG	2 cut(s)	71, 1556
BsrI	ACTGG	2 cut(s)	144, 780
BssMI	GATC	9 cut(s)	151, 343, 366, 430, 631, 1165, 1271, 1298, 1384
BssSI	CACGAG	1 cut(s)	672
Bst2BI	CACGAG	1 cut(s)	672
Bst4CI	ACNGT	3 cut(s)	1126, 1189, 1480
BstAPI	GCANNNNNTGC	1 cut(s)	61
BstDEI	CTNAG	8 cut(s)	144, 275, 747, 1003, 1056, 1065, 1071, 1398
BstF5I	GGATG	8 cut(s)	232, 574, 592, 634, 700, 1093, 1330, 1492
BstKTI	GATC	9 cut(s)	154, 346, 369, 433, 634, 1168, 1274, 1301, 1387
BstMAI	GTCTC	5 cut(s)	482, 1074, 1202, 1283, 1310
BstMBI	GATC	9 cut(s)	151, 343, 366, 430, 631, 1165, 1271, 1298, 1384
BstMWI	GCNNNNNNNGC	4 cut(s)	61, 140, 668, 707
BstNSI	RCATGY	1 cut(s)	242
BstSFI	CTRYAG	2 cut(s)	1251, 1599
BstV1I	GCAGC	6 cut(s)	63, 146, 1091, 1122, 1237, 1585
BstV2I	GAAGAC	1 cut(s)	606
BstX2I	RGATCY	4 cut(s)	343, 430, 1271, 1298
BstYI	RGATCY	4 cut(s)	343, 430, 1271, 1298
BsuI	GTATCC	1 cut(s)	1468
BtsCI	GGATG	8 cut(s)	232, 574, 592, 634, 700, 1093, 1330, 1492
BtsI	GCAGTG	3 cut(s)	717, 1089, 1260
BtsIMutI	CAGTG	7 cut(s)	137, 717, 738, 787, 1089, 1260, 1329
BveI	ACCTGC	1 cut(s)	868
CciI	TCATGA	1 cut(s)	664
Csp6I	GTAC	2 cut(s)	857, 1245
CviAII	CATG	8 cut(s)	239, 296, 317, 353, 389, 665, 719, 824
CviQI	GTAC	2 cut(s)	857, 1245
DdeI	CTNAG	8 cut(s)	144, 275, 747, 1003, 1056, 1065, 1071, 1398
DpnI	GATC	9 cut(s)	153, 345, 368, 432, 633, 1167, 1273, 1300, 1386
DpnII	GATC	9 cut(s)	151, 343, 366, 430, 631, 1165, 1271, 1298, 1384
DrdI	GACNNNNNNGTC	1 cut(s)	1216
DseDI	GACNNNNNNGTC	1 cut(s)	1216
Eco57I	CTGAAG	2 cut(s)	1029, 1425
EcoRI	GAATTC	2 cut(s)	619, 886
FaeI	CATG	8 cut(s)	242, 299, 320, 356, 392, 668, 722, 827
FalI	AAGNNNNNCTT	2 cut(s)	861, 893
FatI	CATG	8 cut(s)	238, 295, 316, 352, 388, 664, 718, 823
FbaI	TGATCA	3 cut(s)	631, 1165, 1384
Fnu4HI	GCNGC	8 cut(s)	14, 77, 135, 1080, 1111, 1251, 1599, 1602
FokI	GGATG	8 cut(s)	239, 581, 599, 641, 707, 1100, 1337, 1499
Fsp4HI	GCNGC	8 cut(s)	14, 77, 135, 1080, 1111, 1251, 1599, 1602
FspBI	CTAG	5 cut(s)	705, 942, 1026, 1101, 1194
GluI	GCNGC	8 cut(s)	14, 77, 135, 1080, 1111, 1251, 1599, 1602
GsuI	CTGGAG	1 cut(s)	1252
Hin1II	CATG	8 cut(s)	242, 299, 320, 356, 392, 668, 722, 827
HincII	GTYRAC	1 cut(s)	1015
HindII	GTYRAC	1 cut(s)	1015
HinfI	GANTC	9 cut(s)	42, 1058, 1175, 1343, 1376, 1409, 1454, 1499, 1508
HphI	GGTGA	5 cut(s)	61, 569, 584, 662, 1454
Hpy166II	GTNNAC	3 cut(s)	857, 947, 1015
Hpy188III	TCNNGA	7 cut(s)	434, 635, 665, 1199, 1269, 1388, 1484
Hpy8I	GTNNAC	3 cut(s)	857, 947, 1015
HpyAV	CCTTC	9 cut(s)	124, 224, 437, 491, 559, 638, 875, 1433, 1439
HpyCH4III	ACNGT	3 cut(s)	1126, 1189, 1480
HpyF10VI	GCNNNNNNNGC	4 cut(s)	61, 140, 668, 707
HpyF3I	CTNAG	8 cut(s)	144, 275, 747, 1003, 1056, 1065, 1071, 1398
Hsp92II	CATG	8 cut(s)	242, 299, 320, 356, 392, 668, 722, 827
Ksp22I	TGATCA	3 cut(s)	631, 1165, 1384
Kzo9I	GATC	9 cut(s)	151, 343, 366, 430, 631, 1165, 1271, 1298, 1384
LguI	GCTCTTC	2 cut(s)	321, 393
LmnI	GCTCC	2 cut(s)	452, 1271
Lsp1109I	GCAGC	6 cut(s)	63, 146, 1091, 1122, 1237, 1585
LweI	GCATC	5 cut(s)	688, 910, 1315, 1348, 1381
MaeI	CTAG	5 cut(s)	705, 942, 1026, 1101, 1194
MaeIII	GTNAC	4 cut(s)	229, 572, 712, 1096
MalI	GATC	9 cut(s)	153, 345, 368, 432, 633, 1167, 1273, 1300, 1386
MboI	GATC	9 cut(s)	151, 343, 366, 430, 631, 1165, 1271, 1298, 1384
MfeI	CAATTG	1 cut(s)	1169
MflI	RGATCY	4 cut(s)	343, 430, 1271, 1298
MluCI	AATT	3 cut(s)	619, 886, 1169
MlyI	GAGTC	4 cut(s)	1067, 1352, 1385, 1448
MseI	TTAA	1 cut(s)	1232
MslI	CAYNNNNRTG	1 cut(s)	120
MspA1I	CMGCKG	1 cut(s)	1250
MunI	CAATTG	1 cut(s)	1169
Mva1269I	GAATGC	3 cut(s)	115, 664, 1081
MwoI	GCNNNNNNNGC	4 cut(s)	61, 140, 668, 707
NdeII	GATC	9 cut(s)	151, 343, 366, 430, 631, 1165, 1271, 1298, 1384
NlaIII	CATG	8 cut(s)	242, 299, 320, 356, 392, 668, 722, 827
NlaIV	GGNNCC	2 cut(s)	26, 345
NmuCI	GTSAC	3 cut(s)	229, 572, 712
NspI	RCATGY	1 cut(s)	242
PagI	TCATGA	1 cut(s)	664
PciI	ACATGT	1 cut(s)	238
PciSI	GCTCTTC	2 cut(s)	321, 393
PctI	GAATGC	3 cut(s)	115, 664, 1081
PfeI	GAWTC	5 cut(s)	42, 1175, 1409, 1499, 1508
PkrI	GCNGC	8 cut(s)	15, 78, 136, 1081, 1112, 1252, 1600, 1603
PleI	GAGTC	4 cut(s)	1066, 1351, 1384, 1448
PpsI	GAGTC	4 cut(s)	1066, 1351, 1384, 1448
PscI	ACATGT	1 cut(s)	238
PsiI	TTATAA	2 cut(s)	687, 734
PspN4I	GGNNCC	2 cut(s)	26, 345
PstI	CTGCAG	2 cut(s)	1255, 1603
PsuI	RGATCY	4 cut(s)	343, 430, 1271, 1298
PvuII	CAGCTG	1 cut(s)	1250
RsaI	GTAC	2 cut(s)	858, 1246
RsaNI	GTAC	2 cut(s)	857, 1245
RseI	CAYNNNNRTG	1 cut(s)	120
SapI	GCTCTTC	2 cut(s)	321, 393
SaqAI	TTAA	1 cut(s)	1232
SatI	GCNGC	8 cut(s)	14, 77, 135, 1080, 1111, 1251, 1599, 1602
Sau3AI	GATC	9 cut(s)	151, 343, 366, 430, 631, 1165, 1271, 1298, 1384
SchI	GAGTC	4 cut(s)	1067, 1352, 1385, 1448
SfaNI	GCATC	5 cut(s)	688, 910, 1315, 1348, 1381
SfcI	CTRYAG	2 cut(s)	1251, 1599
SmiMI	CAYNNNNRTG	1 cut(s)	120
SmlI	CTYRAG	1 cut(s)	110
SmoI	CTYRAG	1 cut(s)	110
SpeI	ACTAGT	1 cut(s)	1025
Sse9I	AATT	3 cut(s)	619, 886, 1169
SsiI	CCGC	3 cut(s)	14, 950, 1031
SspMI	CTAG	5 cut(s)	705, 942, 1026, 1101, 1194
TaaI	ACNGT	3 cut(s)	1126, 1189, 1480
TaqI	TCGA	3 cut(s)	154, 369, 1412
TaqII	GACCGA	1 cut(s)	618
TasI	AATT	3 cut(s)	619, 886, 1169
TauI	GCSGC	1 cut(s)	16
TfiI	GAWTC	5 cut(s)	42, 1175, 1409, 1499, 1508
Tru1I	TTAA	1 cut(s)	1232
Tru9I	TTAA	1 cut(s)	1232
TscAI	CASTG	7 cut(s)	144, 717, 745, 787, 1089, 1260, 1336
TseFI	GTSAC	3 cut(s)	229, 572, 712
TseI	GCWGC	7 cut(s)	76, 134, 1079, 1110, 1250, 1598, 1601
Tsp45I	GTSAC	3 cut(s)	229, 572, 712
TspGWI	ACGGA	3 cut(s)	194, 1337, 1484
TspRI	CASTG	7 cut(s)	144, 717, 745, 787, 1089, 1260, 1336
XapI	RAATTY	2 cut(s)	619, 886
XceI	RCATGY	1 cut(s)	242
XspI	CTAG	5 cut(s)	705, 942, 1026, 1101, 1194

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.