Rmu_sc0002045.1_g000042

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002045.1
Physical Location & Seq
Forward (+)
218478 .. 219902
1425 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002045.1_g000042.1.cds

Sequence Viewer

Length: 363 bp
atgaccagagatgttggaactcaaagcactcctcctgatatcagttctagcagtcttagctctgcttcaactcctcccattgtagaaagatcattaaatcgatttcgtggcggagattcaccaaattcaaattcaaattcaaattcaaaaccaaaatctgaagaagaggttgaagaagaagagatggaagtgaaagatacagaagaggaagaagaaacaaaaagggaaaaggaagagagaaagaaaaaagaagagcaaaagtggaggcaaggtgggtgcttgtcatggatgagaaaaaggtacagagagaaacacaaaccaagaaagaagaatatgtttctttctcatctcaaagcgtgctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

120

Amino Acids

13.99

Weight (kDa)

8.53

Isoelectric Point (pI)

74.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 111
AcsI RAATTY 4 cut(s) 124, 130, 136, 142
AcuI CTGAAG 1 cut(s) 180
AfaI GTAC 1 cut(s) 302
AgsI TTSAA 6 cut(s) 69, 129, 135, 141, 147, 173
AjuI GAANNNNNNNTTGG 2 cut(s) 115, 147
AluBI AGCT 1 cut(s) 60
AluI AGCT 1 cut(s) 60
ApoI RAATTY 4 cut(s) 124, 130, 136, 142
AsuHPI GGTGA 1 cut(s) 111
BccI CCATC 1 cut(s) 178
BfaI CTAG 1 cut(s) 48
Bsa29I ATCGAT 1 cut(s) 100
BsaXI ACNNNNNCTCC 2 cut(s) 256, 286
BseCI ATCGAT 1 cut(s) 100
BseGI GGATG 1 cut(s) 294
BseRI GAGGAG 2 cut(s) 21, 63
BshVI ATCGAT 1 cut(s) 100
Bsp143I GATC 1 cut(s) 89
BspACI CCGC 1 cut(s) 111
BspDI ATCGAT 1 cut(s) 100
BspQI GCTCTTC 1 cut(s) 246
BssMI GATC 1 cut(s) 89
Bst6I CTCTTC 5 cut(s) 159, 174, 198, 228, 246
BstC8I GCNNGC 1 cut(s) 358
BstDEI CTNAG 1 cut(s) 56
BstF5I GGATG 1 cut(s) 294
BstKTI GATC 1 cut(s) 92
BstMBI GATC 1 cut(s) 89
BstMWI GCNNNNNNNGC 1 cut(s) 57
Bsu15I ATCGAT 1 cut(s) 100
BsuTUI ATCGAT 1 cut(s) 100
BtsCI GGATG 1 cut(s) 294
Cac8I GCNNGC 1 cut(s) 358
ClaI ATCGAT 1 cut(s) 100
Csp6I GTAC 1 cut(s) 301
CviAII CATG 1 cut(s) 285
CviJI RGCY 1 cut(s) 60
CviKI_1 RGCY 1 cut(s) 60
CviQI GTAC 1 cut(s) 301
DdeI CTNAG 1 cut(s) 56
DpnI GATC 1 cut(s) 91
DpnII GATC 1 cut(s) 89
Eam1104I CTCTTC 5 cut(s) 159, 174, 198, 228, 246
EarI CTCTTC 5 cut(s) 159, 174, 198, 228, 246
EciI GGCGGA 1 cut(s) 126
Eco32I GATATC 1 cut(s) 40
Eco57I CTGAAG 1 cut(s) 180
EcoRV GATATC 1 cut(s) 40
FaeI CATG 1 cut(s) 288
FaiI YATR 2 cut(s) 286, 335
FatI CATG 1 cut(s) 284
FokI GGATG 1 cut(s) 301
FspBI CTAG 1 cut(s) 48
Hin1II CATG 1 cut(s) 288
HinfI GANTC 1 cut(s) 116
HphI GGTGA 1 cut(s) 111
Hpy188I TCNGA 1 cut(s) 160
Hpy188III TCNNGA 1 cut(s) 35
HpyF10VI GCNNNNNNNGC 1 cut(s) 57
HpyF3I CTNAG 1 cut(s) 56
Hsp92II CATG 1 cut(s) 288
Kzo9I GATC 1 cut(s) 89
LguI GCTCTTC 1 cut(s) 246
LpnPI CCDG 2 cut(s) 19, 48
MaeI CTAG 1 cut(s) 48
MalI GATC 1 cut(s) 91
MboI GATC 1 cut(s) 89
MluCI AATT 4 cut(s) 124, 130, 136, 142
MnlI CCTC 5 cut(s) 42, 84, 160, 199, 258
MseI TTAA 1 cut(s) 95
MwoI GCNNNNNNNGC 1 cut(s) 57
NdeII GATC 1 cut(s) 89
NlaIII CATG 1 cut(s) 288
PciSI GCTCTTC 1 cut(s) 246
PfeI GAWTC 1 cut(s) 116
RsaI GTAC 1 cut(s) 302
RsaNI GTAC 1 cut(s) 301
SapI GCTCTTC 1 cut(s) 246
SaqAI TTAA 1 cut(s) 95
Sau3AI GATC 1 cut(s) 89
SetI ASST 4 cut(s) 62, 171, 274, 302
SgeI CNNG 8 cut(s) 18, 47, 60, 119, 281, 292, 297, 333
Sse9I AATT 4 cut(s) 124, 130, 136, 142
SsiI CCGC 1 cut(s) 111
SspMI CTAG 1 cut(s) 48
TaqI TCGA 1 cut(s) 100
TasI AATT 4 cut(s) 124, 130, 136, 142
TfiI GAWTC 1 cut(s) 116
Tru1I TTAA 1 cut(s) 95
Tru9I TTAA 1 cut(s) 95
XapI RAATTY 4 cut(s) 124, 130, 136, 142
XspI CTAG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.