Rh5DG319800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0006085
Physical Location & Seq
Forward (+)
41182983 .. 41185151
2169 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG319800.1

Sequence Viewer

Length: 345 bp
ATGGAAGAATCCCCATATAGTTCCCTGGGACGAGAGGAACCTGAGTTCAGCTTGAGAGATTGGGCTGCCAAGGCTAGAGGAATCAGCCGGGTAAACACAAATTCCAGAAGGTTCTCAGCATCCTACATTAGAAGATTTATAGAAGACACAAGGTCTTTCAGTTCAAACATTACCATCTCTAGCACTGCTTCTTCTCCTGGCTATGCCTTAAGAGATGAAATTGACCCTGCAACTTACTCATTCACCACGGCCCTCAAAGCATTACAAGCAAGGTCTGCCTGCAATAGTTGGGAGGCTTTATCCCCAGATGGGTTTGCTTTACATTCAAAGTGGTCTTGCAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

114

Amino Acids

12.75

Weight (kDa)

8.68

Isoelectric Point (pI)

79.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 100
AfiI CCNNNNNNNGG 1 cut(s) 309
AflII CTTAAG 1 cut(s) 208
AgsI TTSAA 2 cut(s) 165, 327
AhdI GACNNNNNGTC 1 cut(s) 151
AjnI CCWGG 2 cut(s) 24, 196
AloI GAACNNNNNNTCC 2 cut(s) 29, 61
AluBI AGCT 1 cut(s) 51
AluI AGCT 1 cut(s) 51
AoxI GGCC 1 cut(s) 249
ApeKI GCWGC 1 cut(s) 65
ApoI RAATTY 1 cut(s) 100
AspS9I GGNCC 1 cut(s) 250
AsuC2I CCSGG 1 cut(s) 89
AsuHPI GGTGA 1 cut(s) 235
BbsI GAAGAC 1 cut(s) 150
BbvI GCAGC 1 cut(s) 52
BccI CCATC 2 cut(s) 182, 302
BceAI ACGGC 1 cut(s) 264
BciT130I CCWGG 2 cut(s) 26, 198
BcnI CCSGG 1 cut(s) 89
BfaI CTAG 2 cut(s) 75, 180
BfrI CTTAAG 1 cut(s) 208
BisI GCNGC 1 cut(s) 66
BlsI GCNGC 1 cut(s) 67
Bme1390I CCNGG 3 cut(s) 26, 89, 198
BmeRI GACNNNNNGTC 1 cut(s) 151
BmgT120I GGNCC 1 cut(s) 250
BmiI GGNNCC 1 cut(s) 39
BmrFI CCNGG 3 cut(s) 26, 89, 198
BmsI GCATC 1 cut(s) 128
BpiI GAAGAC 1 cut(s) 150
BpuEI CTTGAG 1 cut(s) 73
BpuMI CCSGG 1 cut(s) 89
BsaJI CCNNGG 4 cut(s) 24, 25, 69, 246
Bsc4I CCNNNNNNNGG 1 cut(s) 309
BseBI CCWGG 2 cut(s) 26, 198
BseDI CCNNGG 4 cut(s) 24, 25, 69, 246
BseGI GGATG 1 cut(s) 119
BseLI CCNNNNNNNGG 1 cut(s) 309
BseMII CTCAG 2 cut(s) 33, 129
BseXI GCAGC 1 cut(s) 52
BshFI GGCC 1 cut(s) 251
BsiSI CCGG 1 cut(s) 88
BslFI GGGAC 1 cut(s) 42
BslI CCNNNNNNNGG 1 cut(s) 309
BsmFI GGGAC 1 cut(s) 42
BsnI GGCC 1 cut(s) 251
BspANI GGCC 1 cut(s) 251
BspCNI CTCAG 2 cut(s) 34, 128
BspLI GGNNCC 1 cut(s) 39
BspTI CTTAAG 1 cut(s) 208
BssECI CCNNGG 4 cut(s) 24, 25, 69, 246
BssT1I CCWWGG 1 cut(s) 69
Bst2UI CCWGG 2 cut(s) 26, 198
BstAFI CTTAAG 1 cut(s) 208
BstAPI GCANNNNNTGC 1 cut(s) 275
BstC8I GCNNGC 1 cut(s) 280
BstDEI CTNAG 2 cut(s) 42, 115
BstDSI CCRYGG 1 cut(s) 246
BstF5I GGATG 1 cut(s) 119
BstMWI GCNNNNNNNGC 4 cut(s) 71, 257, 266, 275
BstNI CCWGG 2 cut(s) 26, 198
BstSCI CCNGG 3 cut(s) 24, 87, 196
BstV1I GCAGC 1 cut(s) 52
BstV2I GAAGAC 1 cut(s) 150
BsuRI GGCC 1 cut(s) 251
BtgI CCRYGG 1 cut(s) 246
BtsCI GGATG 1 cut(s) 119
BtsI GCAGTG 1 cut(s) 183
BtsIMutI CAGTG 1 cut(s) 183
Cac8I GCNNGC 1 cut(s) 280
Cfr13I GGNCC 1 cut(s) 250
CviJI RGCY 7 cut(s) 51, 65, 74, 87, 201, 251, 296
CviKI_1 RGCY 7 cut(s) 51, 65, 74, 87, 201, 251, 296
DdeI CTNAG 2 cut(s) 42, 115
DriI GACNNNNNGTC 1 cut(s) 151
Eam1105I GACNNNNNGTC 1 cut(s) 151
Eco130I CCWWGG 1 cut(s) 69
EcoRII CCWGG 2 cut(s) 24, 196
EcoT14I CCWWGG 1 cut(s) 69
ErhI CCWWGG 1 cut(s) 69
FaiI YATR 4 cut(s) 16, 18, 140, 204
FaqI GGGAC 1 cut(s) 42
Fnu4HI GCNGC 1 cut(s) 66
FokI GGATG 1 cut(s) 106
Fsp4HI GCNGC 1 cut(s) 66
FspBI CTAG 2 cut(s) 75, 180
GluI GCNGC 1 cut(s) 66
HaeIII GGCC 1 cut(s) 251
HapII CCGG 1 cut(s) 88
HinfI GANTC 2 cut(s) 8, 81
HpaII CCGG 1 cut(s) 88
HphI GGTGA 1 cut(s) 235
Hpy166II GTNNAC 1 cut(s) 94
Hpy188III TCNNGA 1 cut(s) 105
Hpy8I GTNNAC 1 cut(s) 94
HpyAV CCTTC 1 cut(s) 102
HpyCH4V TGCA 3 cut(s) 230, 282, 339
HpyF10VI GCNNNNNNNGC 4 cut(s) 71, 257, 266, 275
HpyF3I CTNAG 2 cut(s) 42, 115
Lsp1109I GCAGC 1 cut(s) 52
LweI GCATC 1 cut(s) 128
MaeI CTAG 2 cut(s) 75, 180
MboII GAAGA 4 cut(s) 17, 144, 155, 183
MluCI AATT 2 cut(s) 100, 219
MnlI CCTC 4 cut(s) 28, 71, 263, 286
MseI TTAA 1 cut(s) 209
MspCI CTTAAG 1 cut(s) 208
MspI CCGG 1 cut(s) 88
MspR9I CCNGG 3 cut(s) 26, 89, 198
MvaI CCWGG 2 cut(s) 26, 198
MwoI GCNNNNNNNGC 4 cut(s) 71, 257, 266, 275
NciI CCSGG 1 cut(s) 89
NlaIV GGNNCC 1 cut(s) 39
PasI CCCWGGG 1 cut(s) 25
PfeI GAWTC 2 cut(s) 8, 81
PkrI GCNGC 1 cut(s) 67
Psp6I CCWGG 2 cut(s) 24, 196
PspGI CCWGG 2 cut(s) 24, 196
PspN4I GGNNCC 1 cut(s) 39
PspPI GGNCC 1 cut(s) 250
SaqAI TTAA 1 cut(s) 209
SatI GCNGC 1 cut(s) 66
Sau96I GGNCC 1 cut(s) 250
ScrFI CCNGG 3 cut(s) 26, 89, 198
SetI ASST 5 cut(s) 43, 53, 113, 155, 275
SfaNI GCATC 1 cut(s) 128
SmlI CTYRAG 2 cut(s) 52, 208
SmoI CTYRAG 2 cut(s) 52, 208
Sse9I AATT 2 cut(s) 100, 219
SspMI CTAG 2 cut(s) 75, 180
StyD4I CCNGG 3 cut(s) 24, 87, 196
StyI CCWWGG 1 cut(s) 69
TasI AATT 2 cut(s) 100, 219
TfiI GAWTC 2 cut(s) 8, 81
Tru1I TTAA 1 cut(s) 209
Tru9I TTAA 1 cut(s) 209
TscAI CASTG 1 cut(s) 190
TseI GCWGC 1 cut(s) 65
TspDTI ATGAA 1 cut(s) 231
TspRI CASTG 1 cut(s) 190
Vha464I CTTAAG 1 cut(s) 208
XapI RAATTY 1 cut(s) 100
XspI CTAG 2 cut(s) 75, 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.