Rmu_sc0002111.1_g000038

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002111.1
OG0013736
Physical Location & Seq
Reverse (-)
208537 .. 209702
1166 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002111.1_g000038.1.cds

Sequence Viewer

Length: 369 bp
atggtagagggagaatatgttaggcctcatcaacgggcggggccgagccgagcccggcccattggtagcgggcttgggaatttgtccagcttgaatcttggcgaagagatttcgccaacccttggagatctgggaaacttggaatccatgaatttatctgacaataatccgtctggagacatacctttctcagtttcaaagcttaagaaccttgaggttttgaatttgaagaacaatcagttgactagtcctattgctacaactcttacccaaattccaaaccttagaactcttgatctttctcggaaccagctcactggtgagataccaaggctaatatcttggaatgaagttttgcagtacctgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

122

Amino Acids

13.33

Weight (kDa)

5.31

Isoelectric Point (pI)

33.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 122
AciI CCGC 2 cut(s) 38, 69
AcsI RAATTY 4 cut(s) 79, 151, 223, 273
AfaI GTAC 1 cut(s) 362
AfiI CCNNNNNNNGG 1 cut(s) 122
AflII CTTAAG 1 cut(s) 203
AgsI TTSAA 4 cut(s) 94, 198, 223, 229
AhlI ACTAGT 1 cut(s) 245
AluBI AGCT 3 cut(s) 90, 202, 313
AluI AGCT 3 cut(s) 90, 202, 313
Alw26I GTCTC 1 cut(s) 171
AlwNI CAGNNNCTG 1 cut(s) 364
AoxI GGCC 3 cut(s) 23, 41, 56
ApoI RAATTY 4 cut(s) 79, 151, 223, 273
AspS9I GGNCC 2 cut(s) 41, 57
AsuC2I CCSGG 1 cut(s) 55
AsuHPI GGTGA 1 cut(s) 332
BanII GRGCYC 1 cut(s) 55
BcnI CCSGG 1 cut(s) 55
BcoDI GTCTC 1 cut(s) 171
BcuI ACTAGT 1 cut(s) 245
BfaI CTAG 1 cut(s) 246
BfrI CTTAAG 1 cut(s) 203
BglII AGATCT 1 cut(s) 127
Bme1390I CCNGG 1 cut(s) 55
BmgT120I GGNCC 2 cut(s) 41, 57
BmiI GGNNCC 2 cut(s) 42, 308
BmrFI CCNGG 1 cut(s) 55
BpmI CTGGAG 1 cut(s) 195
BpuEI CTTGAG 1 cut(s) 233
BpuMI CCSGG 1 cut(s) 55
BsaJI CCNNGG 2 cut(s) 121, 329
BsaXI ACNNNNNCTCC 1 cut(s) 33
Bsc4I CCNNNNNNNGG 1 cut(s) 122
Bse1I ACTGG 1 cut(s) 322
BseDI CCNNGG 2 cut(s) 121, 329
BseLI CCNNNNNNNGG 1 cut(s) 122
BseMII CTCAG 1 cut(s) 204
BseNI ACTGG 1 cut(s) 322
BshFI GGCC 3 cut(s) 25, 43, 58
BsiSI CCGG 1 cut(s) 55
BslI CCNNNNNNNGG 1 cut(s) 122
BsmAI GTCTC 1 cut(s) 171
BsnI GGCC 3 cut(s) 25, 43, 58
Bsp1286I GDGCHC 1 cut(s) 55
Bsp143I GATC 2 cut(s) 127, 295
BspACI CCGC 2 cut(s) 38, 69
BspANI GGCC 3 cut(s) 25, 43, 58
BspCNI CTCAG 1 cut(s) 203
BspLI GGNNCC 2 cut(s) 42, 308
BspTI CTTAAG 1 cut(s) 203
BsrI ACTGG 1 cut(s) 322
BssECI CCNNGG 2 cut(s) 121, 329
BssMI GATC 2 cut(s) 127, 295
BssT1I CCWWGG 2 cut(s) 121, 329
Bst6I CTCTTC 1 cut(s) 99
BstAFI CTTAAG 1 cut(s) 203
BstC8I GCNNGC 1 cut(s) 71
BstDEI CTNAG 2 cut(s) 190, 284
BstKTI GATC 2 cut(s) 130, 298
BstMAI GTCTC 1 cut(s) 171
BstMBI GATC 2 cut(s) 127, 295
BstSCI CCNGG 1 cut(s) 53
BstX2I RGATCY 1 cut(s) 127
BstXI CCANNNNNNTGG 1 cut(s) 317
BstYI RGATCY 1 cut(s) 127
BsuRI GGCC 3 cut(s) 25, 43, 58
BtsIMutI CAGTG 1 cut(s) 315
Cac8I GCNNGC 1 cut(s) 71
CaiI CAGNNNCTG 1 cut(s) 364
Cfr13I GGNCC 2 cut(s) 41, 57
Csp6I GTAC 1 cut(s) 361
CviAII CATG 1 cut(s) 148
CviQI GTAC 1 cut(s) 361
DdeI CTNAG 2 cut(s) 190, 284
DpnI GATC 2 cut(s) 129, 297
DpnII GATC 2 cut(s) 127, 295
Eam1104I CTCTTC 1 cut(s) 99
EarI CTCTTC 1 cut(s) 99
Eco130I CCWWGG 2 cut(s) 121, 329
Eco147I AGGCCT 1 cut(s) 25
Eco24I GRGCYC 1 cut(s) 55
EcoT14I CCWWGG 2 cut(s) 121, 329
EcoT38I GRGCYC 1 cut(s) 55
ErhI CCWWGG 2 cut(s) 121, 329
FaeI CATG 1 cut(s) 151
FaiI YATR 3 cut(s) 18, 149, 182
FatI CATG 1 cut(s) 147
FauI CCCGC 2 cut(s) 31, 62
FriOI GRGCYC 1 cut(s) 55
FspBI CTAG 1 cut(s) 246
GsuI CTGGAG 1 cut(s) 195
HaeIII GGCC 3 cut(s) 25, 43, 58
HapII CCGG 1 cut(s) 55
Hin1II CATG 1 cut(s) 151
HincII GTYRAC 1 cut(s) 243
HindII GTYRAC 1 cut(s) 243
HindIII AAGCTT 1 cut(s) 200
HinfI GANTC 2 cut(s) 94, 143
HpaII CCGG 1 cut(s) 55
HphI GGTGA 1 cut(s) 332
Hpy166II GTNNAC 1 cut(s) 243
Hpy188I TCNGA 2 cut(s) 160, 306
Hpy188III TCNNGA 2 cut(s) 174, 293
Hpy8I GTNNAC 1 cut(s) 243
HpyCH4V TGCA 1 cut(s) 358
HpyF3I CTNAG 2 cut(s) 190, 284
Hsp92II CATG 1 cut(s) 151
Kzo9I GATC 2 cut(s) 127, 295
LpnPI CCDG 6 cut(s) 68, 100, 116, 159, 303, 323
MaeI CTAG 1 cut(s) 246
MalI GATC 2 cut(s) 129, 297
MboI GATC 2 cut(s) 127, 295
MboII GAAGA 2 cut(s) 116, 241
MflI RGATCY 1 cut(s) 127
MhlI GDGCHC 1 cut(s) 55
MluCI AATT 4 cut(s) 79, 151, 223, 273
MnlI CCTC 2 cut(s) 36, 208
MseI TTAA 1 cut(s) 204
MspCI CTTAAG 1 cut(s) 203
MspI CCGG 1 cut(s) 55
MspR9I CCNGG 1 cut(s) 55
NciI CCSGG 1 cut(s) 55
NdeII GATC 2 cut(s) 127, 295
NlaIII CATG 1 cut(s) 151
NlaIV GGNNCC 2 cut(s) 42, 308
NmeAIII GCCGAG 2 cut(s) 69, 74
PceI AGGCCT 1 cut(s) 25
PfeI GAWTC 2 cut(s) 94, 143
PflMI CCANNNNNTGG 1 cut(s) 122
PspN4I GGNNCC 2 cut(s) 42, 308
PspPI GGNCC 2 cut(s) 41, 57
PstNI CAGNNNCTG 1 cut(s) 364
PsuI RGATCY 1 cut(s) 127
RsaI GTAC 1 cut(s) 362
RsaNI GTAC 1 cut(s) 361
SaqAI TTAA 1 cut(s) 204
Sau3AI GATC 2 cut(s) 127, 295
Sau96I GGNCC 2 cut(s) 41, 57
ScrFI CCNGG 1 cut(s) 55
SduI GDGCHC 1 cut(s) 55
SetI ASST 8 cut(s) 92, 187, 204, 213, 219, 285, 315, 366
SmlI CTYRAG 2 cut(s) 203, 212
SmoI CTYRAG 2 cut(s) 203, 212
SpeI ACTAGT 1 cut(s) 245
Sse9I AATT 4 cut(s) 79, 151, 223, 273
SseBI AGGCCT 1 cut(s) 25
SsiI CCGC 2 cut(s) 38, 69
SspMI CTAG 1 cut(s) 246
StuI AGGCCT 1 cut(s) 25
StyD4I CCNGG 1 cut(s) 53
StyI CCWWGG 2 cut(s) 121, 329
TasI AATT 4 cut(s) 79, 151, 223, 273
TfiI GAWTC 2 cut(s) 94, 143
Tru1I TTAA 1 cut(s) 204
Tru9I TTAA 1 cut(s) 204
TscAI CASTG 1 cut(s) 322
TspDTI ATGAA 2 cut(s) 164, 363
TspGWI ACGGA 1 cut(s) 159
TspRI CASTG 1 cut(s) 322
Van91I CCANNNNNTGG 1 cut(s) 122
Vha464I CTTAAG 1 cut(s) 203
XapI RAATTY 4 cut(s) 79, 151, 223, 273
XspI CTAG 1 cut(s) 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.