Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009850.1

Orthogroup ID

OG0013736

Physical Location & Seq

Genomic Coordinates Reverse (-)

18183 .. 19860

Gene Structure 1678 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009850.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 480 bp

atgccattgaggagctccagcgccttcatcacaccgatgttgcgcgtggctcgcagcaccacccgcccagagaccatgcgaatggtgagttatgcatcgcgcacgcgattgggaactctgccagagcctccgatctatgatttgtttgggtccgttgatggaggagaaggtgactttgaaatggaggaagaacaaggatgttgttatgtggtttgggttgtctctgtctctgctttttcctctagcttcgtcactgaactgaatttatttgacaataatccgtctggagacatacccttctcggtttcaaagcttaagaaccttgaggttttgaatttgaagaacaatcagttgactggtcctatcgctacaactcttatccaaattccaaaccttagaactcttgatctttctcggaaccagctcactggtgagataccaaggctaatatcttggaatgaagttttgcaatacctatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

159

Amino Acids

17.76

Weight (kDa)

4.85

Isoelectric Point (pI)

44.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013736)

Species	Orthologous Gene IDs
malus_domestica	MD07G1055500.v1.1 MD17G1114100.v1.1
rosa_multiflora	Rmu_sc0002111.1_g000038 Rmu_sc0005223.1_g000024 Rmu_sc0005223.1_g000025 Rmu_sc0005664.1_g000044 Rmu_sc0009850.1_g000003
rosa_roxburghii	Rroxscaffold_1G00027310 Rroxscaffold_5G00355040 Rroxscaffold_7G00188050 Rroxscaffold_7G00199140 Rroxscaffold_7G00213780
rosa_rugosa	Rorug03G0293000
rosa_samantha	Rh5AG304200 Rh5AG409800 Rh5BG219300 Rh6BG266900
rosa_wichuraiana	Rw4G016630

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	3 cut(s)	45, 100, 106
AciI	CCGC	1 cut(s)	64
AcsI	RAATTY	3 cut(s)	262, 334, 384
AflII	CTTAAG	1 cut(s)	314
AgsI	TTSAA	4 cut(s)	179, 309, 334, 340
AluBI	AGCT	4 cut(s)	15, 246, 313, 424
AluI	AGCT	4 cut(s)	15, 246, 313, 424
Alw21I	GWGCWC	1 cut(s)	17
Alw26I	GTCTC	4 cut(s)	65, 226, 232, 282
ApeKI	GCWGC	1 cut(s)	54
ApoI	RAATTY	3 cut(s)	262, 334, 384
AspLEI	GCGC	3 cut(s)	23, 45, 102
AspS9I	GGNCC	2 cut(s)	150, 359
AsuHPI	GGTGA	3 cut(s)	97, 182, 443
AvaII	GGWCC	2 cut(s)	150, 359
BanII	GRGCYC	1 cut(s)	17
Bbv12I	GWGCWC	1 cut(s)	17
BbvI	GCAGC	1 cut(s)	66
BccI	CCATC	1 cut(s)	152
BcoDI	GTCTC	4 cut(s)	65, 226, 232, 282
BfaI	CTAG	1 cut(s)	243
BfoI	RGCGCY	1 cut(s)	24
BfrI	CTTAAG	1 cut(s)	314
BisI	GCNGC	1 cut(s)	55
BlsI	GCNGC	1 cut(s)	56
Bme18I	GGWCC	2 cut(s)	150, 359
BmgT120I	GGNCC	2 cut(s)	150, 359
BmiI	GGNNCC	2 cut(s)	151, 419
BmsI	GCATC	1 cut(s)	104
BpmI	CTGGAG	1 cut(s)	306
BpuEI	CTTGAG	1 cut(s)	344
BsaI	GGTCTC	1 cut(s)	65
BsaJI	CCNNGG	1 cut(s)	440
Bse1I	ACTGG	2 cut(s)	361, 433
BseDI	CCNNGG	1 cut(s)	440
BseGI	GGATG	1 cut(s)	203
BseNI	ACTGG	2 cut(s)	361, 433
BseRI	GAGGAG	2 cut(s)	25, 177
BseXI	GCAGC	1 cut(s)	66
Bsh1236I	CGCG	3 cut(s)	45, 100, 106
BsiHKAI	GWGCWC	1 cut(s)	17
BsmAI	GTCTC	4 cut(s)	65, 226, 232, 282
Bso31I	GGTCTC	1 cut(s)	65
Bsp1286I	GDGCHC	1 cut(s)	17
Bsp143I	GATC	2 cut(s)	132, 406
BspACI	CCGC	1 cut(s)	64
BspFNI	CGCG	3 cut(s)	45, 100, 106
BspLI	GGNNCC	2 cut(s)	151, 419
BspTI	CTTAAG	1 cut(s)	314
BspTNI	GGTCTC	1 cut(s)	65
BsrI	ACTGG	2 cut(s)	361, 433
BssECI	CCNNGG	1 cut(s)	440
BssMI	GATC	2 cut(s)	132, 406
BssT1I	CCWWGG	1 cut(s)	440
BstAFI	CTTAAG	1 cut(s)	314
BstC8I	GCNNGC	2 cut(s)	52, 104
BstDEI	CTNAG	1 cut(s)	395
BstF5I	GGATG	1 cut(s)	203
BstFNI	CGCG	3 cut(s)	45, 100, 106
BstH2I	RGCGCY	1 cut(s)	24
BstHHI	GCGC	3 cut(s)	23, 45, 102
BstKTI	GATC	2 cut(s)	135, 409
BstMAI	GTCTC	4 cut(s)	65, 226, 232, 282
BstMBI	GATC	2 cut(s)	132, 406
BstMWI	GCNNNNNNNGC	2 cut(s)	51, 63
BstUI	CGCG	3 cut(s)	45, 100, 106
BstV1I	GCAGC	1 cut(s)	66
BstXI	CCANNNNNNTGG	2 cut(s)	82, 428
BtgZI	GCGATG	1 cut(s)	81
BtsCI	GGATG	1 cut(s)	203
BtsIMutI	CAGTG	2 cut(s)	252, 426
Cac8I	GCNNGC	2 cut(s)	52, 104
CfoI	GCGC	3 cut(s)	23, 45, 102
Cfr13I	GGNCC	2 cut(s)	150, 359
CviAII	CATG	1 cut(s)	76
CviJI	RGCY	7 cut(s)	15, 50, 127, 246, 313, 424, 445
CviKI_1	RGCY	7 cut(s)	15, 50, 127, 246, 313, 424, 445
DdeI	CTNAG	1 cut(s)	395
DpnI	GATC	2 cut(s)	134, 408
DpnII	GATC	2 cut(s)	132, 406
Ecl136II	GAGCTC	1 cut(s)	15
Eco130I	CCWWGG	1 cut(s)	440
Eco24I	GRGCYC	1 cut(s)	17
Eco31I	GGTCTC	1 cut(s)	65
Eco47I	GGWCC	2 cut(s)	150, 359
Eco53kI	GAGCTC	1 cut(s)	15
EcoICRI	GAGCTC	1 cut(s)	15
EcoT14I	CCWWGG	1 cut(s)	440
EcoT22I	ATGCAT	1 cut(s)	97
EcoT38I	GRGCYC	1 cut(s)	17
ErhI	CCWWGG	1 cut(s)	440
FaeI	CATG	1 cut(s)	79
FaiI	YATR	6 cut(s)	77, 93, 138, 207, 293, 478
FatI	CATG	1 cut(s)	75
FauI	CCCGC	1 cut(s)	71
Fnu4HI	GCNGC	1 cut(s)	55
FokI	GGATG	1 cut(s)	210
FriOI	GRGCYC	1 cut(s)	17
Fsp4HI	GCNGC	1 cut(s)	55
FspBI	CTAG	1 cut(s)	243
GlaI	GCGC	3 cut(s)	22, 44, 101
GluI	GCNGC	1 cut(s)	55
GsuI	CTGGAG	1 cut(s)	306
HaeII	RGCGCY	1 cut(s)	24
HhaI	GCGC	3 cut(s)	23, 45, 102
Hin1II	CATG	1 cut(s)	79
Hin6I	GCGC	3 cut(s)	21, 43, 100
HinP1I	GCGC	3 cut(s)	21, 43, 100
HincII	GTYRAC	1 cut(s)	354
HindII	GTYRAC	1 cut(s)	354
HindIII	AAGCTT	1 cut(s)	311
HphI	GGTGA	3 cut(s)	97, 182, 443
Hpy166II	GTNNAC	1 cut(s)	354
Hpy188I	TCNGA	2 cut(s)	132, 417
Hpy188III	TCNNGA	2 cut(s)	285, 404
Hpy8I	GTNNAC	1 cut(s)	354
HpyAV	CCTTC	3 cut(s)	34, 161, 307
HpyCH4V	TGCA	2 cut(s)	95, 469
HpyF10VI	GCNNNNNNNGC	2 cut(s)	51, 63
HpyF3I	CTNAG	1 cut(s)	395
Hsp92II	CATG	1 cut(s)	79
HspAI	GCGC	3 cut(s)	21, 43, 100
Kzo9I	GATC	2 cut(s)	132, 406
LmnI	GCTCC	2 cut(s)	12, 20
LpnPI	CCDG	7 cut(s)	31, 81, 135, 270, 342, 414, 434
Lsp1109I	GCAGC	1 cut(s)	66
LweI	GCATC	1 cut(s)	104
MaeI	CTAG	1 cut(s)	243
MaeIII	GTNAC	2 cut(s)	170, 250
MalI	GATC	2 cut(s)	134, 408
MboI	GATC	2 cut(s)	132, 406
MboII	GAAGA	2 cut(s)	200, 352
MhlI	GDGCHC	1 cut(s)	17
MluCI	AATT	3 cut(s)	262, 334, 384
MnlI	CCTC	6 cut(s)	3, 138, 155, 178, 250, 319
Mph1103I	ATGCAT	1 cut(s)	97
MseI	TTAA	1 cut(s)	315
MslI	CAYNNNNRTG	2 cut(s)	35, 80
MspCI	CTTAAG	1 cut(s)	314
MvnI	CGCG	3 cut(s)	45, 100, 106
MwoI	GCNNNNNNNGC	2 cut(s)	51, 63
NdeII	GATC	2 cut(s)	132, 406
NlaIII	CATG	1 cut(s)	79
NlaIV	GGNNCC	2 cut(s)	151, 419
NmuCI	GTSAC	2 cut(s)	170, 250
NsiI	ATGCAT	1 cut(s)	97
PkrI	GCNGC	1 cut(s)	56
Psp124BI	GAGCTC	1 cut(s)	17
PspN4I	GGNNCC	2 cut(s)	151, 419
PspPI	GGNCC	2 cut(s)	150, 359
RseI	CAYNNNNRTG	2 cut(s)	35, 80
SacI	GAGCTC	1 cut(s)	17
SaqAI	TTAA	1 cut(s)	315
SatI	GCNGC	1 cut(s)	55
Sau3AI	GATC	2 cut(s)	132, 406
Sau96I	GGNCC	2 cut(s)	150, 359
SduI	GDGCHC	1 cut(s)	17
SetI	ASST	9 cut(s)	17, 172, 248, 315, 324, 330, 396, 426, 477
SfaNI	GCATC	1 cut(s)	104
SinI	GGWCC	2 cut(s)	150, 359
SmiMI	CAYNNNNRTG	2 cut(s)	35, 80
SmlI	CTYRAG	2 cut(s)	314, 323
SmoI	CTYRAG	2 cut(s)	314, 323
Sse9I	AATT	3 cut(s)	262, 334, 384
SsiI	CCGC	1 cut(s)	64
SspMI	CTAG	1 cut(s)	243
SstI	GAGCTC	1 cut(s)	17
StyI	CCWWGG	1 cut(s)	440
TasI	AATT	3 cut(s)	262, 334, 384
Tru1I	TTAA	1 cut(s)	315
Tru9I	TTAA	1 cut(s)	315
TscAI	CASTG	2 cut(s)	259, 433
TseFI	GTSAC	2 cut(s)	170, 250
TseI	GCWGC	1 cut(s)	54
Tsp45I	GTSAC	2 cut(s)	170, 250
TspDTI	ATGAA	2 cut(s)	16, 474
TspGWI	ACGGA	2 cut(s)	142, 270
TspRI	CASTG	2 cut(s)	259, 433
Vha464I	CTTAAG	1 cut(s)	314
VpaK11BI	GGWCC	2 cut(s)	150, 359
XapI	RAATTY	3 cut(s)	262, 334, 384
XspI	CTAG	1 cut(s)	243
Zsp2I	ATGCAT	1 cut(s)	97

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.