Rh6BG266900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0013736
Physical Location & Seq
Reverse (-)
48240883 .. 48248640
7758 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG266900.1

Sequence Viewer

Length: 246 bp
ATGTCGCATATTAAACATGTCCTGAAATTAATCAAGTATTTGGCTCAGTGGGTCACCTTCTTAAGCTCCTTCAAAAGTTCAAATCAAAGCTGGTCCACTACATTACGTGCATTCAGAAGGAGAAACCAGATCGGCGAAAAACAGGAATTTGTCCAGCTTGAATCTTGGCGGGGAGATTTCGCCAGCCCTTGGAGATTTGGGAAACTTGGAATCCATGCATCAATGGCATCCAGAATCATTTGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

9.53

Weight (kDa)

11.0

Isoelectric Point (pI)

52.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 189
AciI CCGC 1 cut(s) 169
AcsI RAATTY 1 cut(s) 146
AfiI CCNNNNNNNGG 1 cut(s) 189
AflII CTTAAG 1 cut(s) 61
AflIII ACRYGT 1 cut(s) 16
AgsI TTSAA 3 cut(s) 73, 81, 161
AluBI AGCT 3 cut(s) 66, 90, 157
AluI AGCT 3 cut(s) 66, 90, 157
ApoI RAATTY 1 cut(s) 146
AseI ATTAAT 1 cut(s) 29
AspS9I GGNCC 1 cut(s) 93
AsuHPI GGTGA 1 cut(s) 46
AvaII GGWCC 1 cut(s) 93
BfrI CTTAAG 1 cut(s) 61
Bme18I GGWCC 1 cut(s) 93
BmgT120I GGNCC 1 cut(s) 93
BmsI GCATC 2 cut(s) 227, 236
BsaAI YACGTR 1 cut(s) 107
BsaJI CCNNGG 1 cut(s) 188
Bsc4I CCNNNNNNNGG 1 cut(s) 189
BseDI CCNNGG 1 cut(s) 188
BseGI GGATG 1 cut(s) 227
BseLI CCNNNNNNNGG 1 cut(s) 189
BseMII CTCAG 1 cut(s) 59
BslI CCNNNNNNNGG 1 cut(s) 189
BsmI GAATGC 1 cut(s) 110
Bsp143I GATC 1 cut(s) 129
BspACI CCGC 1 cut(s) 169
BspCNI CTCAG 1 cut(s) 58
BspTI CTTAAG 1 cut(s) 61
BssECI CCNNGG 1 cut(s) 188
BssMI GATC 1 cut(s) 129
BssT1I CCWWGG 1 cut(s) 188
BstAFI CTTAAG 1 cut(s) 61
BstBAI YACGTR 1 cut(s) 107
BstC8I GCNNGC 1 cut(s) 184
BstDEI CTNAG 1 cut(s) 45
BstEII GGTNACC 1 cut(s) 52
BstF5I GGATG 1 cut(s) 227
BstKTI GATC 1 cut(s) 132
BstMBI GATC 1 cut(s) 129
BstMWI GCNNNNNNNGC 1 cut(s) 224
BstNSI RCATGY 1 cut(s) 20
BstPI GGTNACC 1 cut(s) 52
BtsCI GGATG 1 cut(s) 227
BtsIMutI CAGTG 1 cut(s) 53
Cac8I GCNNGC 1 cut(s) 184
Cfr13I GGNCC 1 cut(s) 93
CviAII CATG 2 cut(s) 17, 215
CviJI RGCY 5 cut(s) 44, 66, 90, 157, 186
CviKI_1 RGCY 5 cut(s) 44, 66, 90, 157, 186
DdeI CTNAG 1 cut(s) 45
DpnI GATC 1 cut(s) 131
DpnII GATC 1 cut(s) 129
Eco130I CCWWGG 1 cut(s) 188
Eco47I GGWCC 1 cut(s) 93
Eco91I GGTNACC 1 cut(s) 52
EcoO65I GGTNACC 1 cut(s) 52
EcoT14I CCWWGG 1 cut(s) 188
EcoT22I ATGCAT 1 cut(s) 220
ErhI CCWWGG 1 cut(s) 188
FaeI CATG 2 cut(s) 20, 218
FaiI YATR 3 cut(s) 9, 18, 216
FatI CATG 2 cut(s) 16, 214
FauI CCCGC 1 cut(s) 162
FokI GGATG 1 cut(s) 214
Hin1II CATG 2 cut(s) 20, 218
HinfI GANTC 3 cut(s) 161, 210, 234
HphI GGTGA 1 cut(s) 46
Hpy166II GTNNAC 1 cut(s) 96
Hpy188I TCNGA 1 cut(s) 116
Hpy188III TCNNGA 2 cut(s) 22, 231
Hpy8I GTNNAC 1 cut(s) 96
HpyAV CCTTC 3 cut(s) 67, 79, 111
HpyCH4IV ACGT 1 cut(s) 106
HpyCH4V TGCA 2 cut(s) 110, 218
HpyF10VI GCNNNNNNNGC 1 cut(s) 224
HpyF3I CTNAG 1 cut(s) 45
HpySE526I ACGT 1 cut(s) 106
Hsp92II CATG 2 cut(s) 20, 218
Kzo9I GATC 1 cut(s) 129
LmnI GCTCC 1 cut(s) 71
LpnPI CCDG 6 cut(s) 35, 76, 128, 140, 167, 196
LweI GCATC 2 cut(s) 227, 236
MaeII ACGT 1 cut(s) 106
MaeIII GTNAC 1 cut(s) 52
MalI GATC 1 cut(s) 131
MboI GATC 1 cut(s) 129
MluCI AATT 2 cut(s) 26, 146
Mph1103I ATGCAT 1 cut(s) 220
MseI TTAA 3 cut(s) 12, 29, 62
MspCI CTTAAG 1 cut(s) 61
Mva1269I GAATGC 1 cut(s) 110
MwoI GCNNNNNNNGC 1 cut(s) 224
NdeII GATC 1 cut(s) 129
NlaIII CATG 2 cut(s) 20, 218
NmuCI GTSAC 1 cut(s) 52
NsiI ATGCAT 1 cut(s) 220
NspI RCATGY 1 cut(s) 20
PciI ACATGT 1 cut(s) 16
PctI GAATGC 1 cut(s) 110
PfeI GAWTC 3 cut(s) 161, 210, 234
PflMI CCANNNNNTGG 1 cut(s) 189
Ppu21I YACGTR 1 cut(s) 107
PscI ACATGT 1 cut(s) 16
PshBI ATTAAT 1 cut(s) 29
PspEI GGTNACC 1 cut(s) 52
PspPI GGNCC 1 cut(s) 93
SaqAI TTAA 3 cut(s) 12, 29, 62
Sau3AI GATC 1 cut(s) 129
Sau96I GGNCC 1 cut(s) 93
SetI ASST 5 cut(s) 59, 68, 92, 109, 159
SfaNI GCATC 2 cut(s) 227, 236
SinI GGWCC 1 cut(s) 93
SmlI CTYRAG 1 cut(s) 61
SmoI CTYRAG 1 cut(s) 61
Sse9I AATT 2 cut(s) 26, 146
SsiI CCGC 1 cut(s) 169
StyI CCWWGG 1 cut(s) 188
TaiI ACGT 1 cut(s) 109
TasI AATT 2 cut(s) 26, 146
TfiI GAWTC 3 cut(s) 161, 210, 234
Tru1I TTAA 3 cut(s) 12, 29, 62
Tru9I TTAA 3 cut(s) 12, 29, 62
TscAI CASTG 1 cut(s) 53
TseFI GTSAC 1 cut(s) 52
Tsp45I GTSAC 1 cut(s) 52
TspRI CASTG 1 cut(s) 53
Van91I CCANNNNNTGG 1 cut(s) 189
Vha464I CTTAAG 1 cut(s) 61
VpaK11BI GGWCC 1 cut(s) 93
VspI ATTAAT 1 cut(s) 29
XapI RAATTY 1 cut(s) 146
XceI RCATGY 1 cut(s) 20
Zsp2I ATGCAT 1 cut(s) 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.