Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002289.1

Orthogroup ID

OG0003241

Physical Location & Seq

Genomic Coordinates Reverse (-)

49948 .. 53081

Gene Structure 3134 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002289.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 804 bp

atgggaaatgctaacggcagagaagaggaggagatccaagatgaggtcgtcgtcaatggccaactagatattgggatggaatccatggaacccttgttctctccccaggttcctgtagctccgcttcaaaggggtgagggcattcctgaatttcctcaaatgttgacgactgaatttcaagttgttcatcatcctcctgaacaaggaattcccaccatgattacatggaactatggtgggaacaatttggctgtggagggttcttgggacaattggaaatctaggaaatcactgcagagatctggtaaggatcattcagttcttttggtcttgccatcaggcatataccggtacaagttcatcgttgatggtgaaccgagatatatcccagatcttccattcatagctgatgaaatgggccatgtttgtaatcttcttgatgttcatgactatgtgccagaaaatttggacagtgtggctgagtttgaggctccggcttccccagaatccagctatgatcaagcatttccagctgaggaagatcttacgaaggaaccagtggttatcccaccacagctgcaactgactgtccttggcatggaggattcaaatgacgattctccaaagcctcgacatgttgtacttaaccacctttttatagaaaaaggatgggcctcacaatctatggtttccctgggactgactcacaggtttgagtctaaatatgtgactgttgtcctatataaatcacttaaaagtcgaagatctagtttgggttcttccaaaaagcagccacgtgtgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04068 ko04152 ko04211 ko04213 ko04371 ko04530 ko04710 ko04714 ko04910 ko04920 ko04921 ko04922 ko04931 ko04932 ko05410 map04068 map04152 map04211 map04213 map04371 map04530 map04710 map04714 map04910 map04920 map04921 map04922 map04931 map04932 map05410

Pfam Domains

Protein Families

AMPK1_CBM AMPKBI

Protein Analysis

267

Amino Acids

29.95

Weight (kDa)

4.87

Isoelectric Point (pI)

56.62

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003241)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G21170 AT5G21170 AT5G21170
fragaria_vesca	FvH4_1g28790 FvH4_1g28790 FvH4_3g00390
malus_domestica	MD05G1360800.v1.1 MD10G1338400.v1.1 MD15G1312500.v1.1
prunus_persica	Prupe.4G004500_v2.0.a1
pyrus_communis	pycom05g32760 pycom10g28820
rosa_chinensis	RchiOBHm_Chr5g0000591 RchiOBHm_Chr5g0050101
rosa_laevigata	RLG00000030878 RLG00000034686
rosa_multiflora	Rmu_sc0002289.1_g000010 Rmu_sc0003699.1_g000005
rosa_roxburghii	Rroxscaffold_1G00031050 Rroxscaffold_1G00075620
rosa_rugosa	Rorug04G0385100 Rorug04G0385100 Rorug04G0385200 Rorug04G0385300.1 Rorug05G0258500 Rorug05G0258600 Rorug05G0258700 Rorug05G0258800
rosa_samantha	Rh5AG004800 Rh5AG330500 Rh5BG006400 Rh5BG341200 Rh5CG005200 Rh5DG005200 Rh5DG354000
rosa_wichuraiana	Rw5G000480 Rw5G031220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	122
AclWI	GGATC	2 cut(s)	28, 318
AcoI	YGGCCR	1 cut(s)	58
AcsI	RAATTY	4 cut(s)	149, 173, 207, 463
AcvI	CACGTG	1 cut(s)	797
AfaI	GTAC	2 cut(s)	353, 642
AfiI	CCNNNNNNNGG	3 cut(s)	43, 203, 598
AflIII	ACRYGT	2 cut(s)	634, 796
AgeI	ACCGGT	1 cut(s)	348
AgsI	TTSAA	3 cut(s)	128, 179, 609
AjnI	CCWGG	2 cut(s)	105, 693
AloI	GAACNNNNNNTCC	2 cut(s)	80, 112
AluBI	AGCT	5 cut(s)	119, 407, 513, 533, 577
AluI	AGCT	5 cut(s)	119, 407, 513, 533, 577
AlwI	GGATC	2 cut(s)	28, 318
AoxI	GGCC	3 cut(s)	58, 418, 672
ApeKI	GCWGC	2 cut(s)	577, 790
ApoI	RAATTY	4 cut(s)	149, 173, 207, 463
AsiGI	ACCGGT	1 cut(s)	348
AspS9I	GGNCC	2 cut(s)	418, 672
AsuHPI	GGTGA	2 cut(s)	146, 383
BalI	TGGCCA	1 cut(s)	60
BarI	GAAGNNNNNNTAC	2 cut(s)	108, 140
BbrPI	CACGTG	1 cut(s)	797
BbvCI	CCTCAGC	1 cut(s)	534
BbvI	GCAGC	1 cut(s)	564
BccI	CCATC	4 cut(s)	70, 343, 362, 663
BceAI	ACGGC	1 cut(s)	31
BciT130I	CCWGG	2 cut(s)	107, 695
BclI	TGATCA	1 cut(s)	517
BfaI	CTAG	3 cut(s)	65, 282, 768
BfmI	CTRYAG	2 cut(s)	114, 293
BglII	AGATCT	4 cut(s)	299, 391, 541, 764
BisI	GCNGC	2 cut(s)	578, 791
BlsI	GCNGC	2 cut(s)	579, 792
Bme1390I	CCNGG	2 cut(s)	107, 695
BmgT120I	GGNCC	2 cut(s)	418, 672
BmiI	GGNNCC	4 cut(s)	90, 111, 492, 555
BmrFI	CCNGG	2 cut(s)	107, 695
BoxI	GACNNNNGTC	1 cut(s)	734
Bpu10I	CCTNAGC	1 cut(s)	534
BsaAI	YACGTR	1 cut(s)	797
BsaJI	CCNNGG	5 cut(s)	84, 105, 592, 693, 694
BsaWI	WCCGGW	1 cut(s)	348
Bsc4I	CCNNNNNNNGG	3 cut(s)	43, 203, 598
Bse118I	RCCGGY	1 cut(s)	348
Bse1I	ACTGG	1 cut(s)	557
BseBI	CCWGG	2 cut(s)	107, 695
BseDI	CCNNGG	5 cut(s)	84, 105, 592, 693, 694
BseGI	GGATG	3 cut(s)	81, 190, 674
BseLI	CCNNNNNNNGG	3 cut(s)	43, 203, 598
BseMII	CTCAG	2 cut(s)	471, 525
BseNI	ACTGG	1 cut(s)	557
BseRI	GAGGAG	2 cut(s)	41, 44
BseXI	GCAGC	1 cut(s)	564
BshFI	GGCC	3 cut(s)	60, 420, 674
BshTI	ACCGGT	1 cut(s)	348
BsiSI	CCGG	2 cut(s)	349, 494
BslFI	GGGAC	2 cut(s)	281, 711
BslI	CCNNNNNNNGG	3 cut(s)	43, 203, 598
BsmFI	GGGAC	2 cut(s)	281, 711
BsmI	GAATGC	1 cut(s)	141
BsnI	GGCC	3 cut(s)	60, 420, 674
Bsp143I	GATC	7 cut(s)	33, 299, 310, 391, 517, 541, 764
Bsp19I	CCATGG	1 cut(s)	84
BspACI	CCGC	1 cut(s)	122
BspANI	GGCC	3 cut(s)	60, 420, 674
BspCNI	CTCAG	2 cut(s)	472, 526
BspHI	TCATGA	1 cut(s)	445
BspLI	GGNNCC	4 cut(s)	90, 111, 492, 555
BspMAI	CTGCAG	1 cut(s)	297
BspPI	GGATC	2 cut(s)	28, 318
BsrFI	RCCGGY	1 cut(s)	348
BsrI	ACTGG	1 cut(s)	557
BssAI	RCCGGY	1 cut(s)	348
BssECI	CCNNGG	5 cut(s)	84, 105, 592, 693, 694
BssMI	GATC	7 cut(s)	33, 299, 310, 391, 517, 541, 764
BssT1I	CCWWGG	2 cut(s)	84, 592
Bst2UI	CCWGG	2 cut(s)	107, 695
Bst4CI	ACNGT	3 cut(s)	473, 589, 733
Bst6I	CTCTTC	1 cut(s)	18
BstBAI	YACGTR	1 cut(s)	797
BstDEI	CTNAG	2 cut(s)	480, 534
BstDSI	CCRYGG	1 cut(s)	84
BstENI	CCTNNNNNAGG	1 cut(s)	201
BstF5I	GGATG	3 cut(s)	81, 190, 674
BstKTI	GATC	7 cut(s)	36, 302, 313, 394, 520, 544, 767
BstMBI	GATC	7 cut(s)	33, 299, 310, 391, 517, 541, 764
BstMWI	GCNNNNNNNGC	1 cut(s)	530
BstNI	CCWGG	2 cut(s)	107, 695
BstNSI	RCATGY	1 cut(s)	638
BstPAI	GACNNNNGTC	1 cut(s)	734
BstSCI	CCNGG	2 cut(s)	105, 693
BstSFI	CTRYAG	2 cut(s)	114, 293
BstV1I	GCAGC	1 cut(s)	564
BstX2I	RGATCY	5 cut(s)	33, 299, 391, 541, 764
BstYI	RGATCY	5 cut(s)	33, 299, 391, 541, 764
BsuRI	GGCC	3 cut(s)	60, 420, 674
BtgI	CCRYGG	1 cut(s)	84
BtsCI	GGATG	3 cut(s)	81, 190, 674
BtsI	GCAGTG	1 cut(s)	290
BtsIMutI	CAGTG	3 cut(s)	290, 478, 564
CciI	TCATGA	1 cut(s)	445
Cfr10I	RCCGGY	1 cut(s)	348
Cfr13I	GGNCC	2 cut(s)	418, 672
Csp6I	GTAC	2 cut(s)	352, 641
CspAI	ACCGGT	1 cut(s)	348
CviAII	CATG	7 cut(s)	85, 217, 225, 422, 446, 598, 635
CviQI	GTAC	2 cut(s)	352, 641
DdeI	CTNAG	2 cut(s)	480, 534
DpnI	GATC	7 cut(s)	35, 301, 312, 393, 519, 543, 766
DpnII	GATC	7 cut(s)	33, 299, 310, 391, 517, 541, 764
EaeI	YGGCCR	1 cut(s)	58
Eam1104I	CTCTTC	1 cut(s)	18
EarI	CTCTTC	1 cut(s)	18
Eco130I	CCWWGG	2 cut(s)	84, 592
Eco72I	CACGTG	1 cut(s)	797
EcoNI	CCTNNNNNAGG	1 cut(s)	201
EcoRI	GAATTC	1 cut(s)	207
EcoRII	CCWGG	2 cut(s)	105, 693
EcoT14I	CCWWGG	2 cut(s)	84, 592
ErhI	CCWWGG	2 cut(s)	84, 592
FaeI	CATG	7 cut(s)	88, 220, 228, 425, 449, 601, 638
FaqI	GGGAC	2 cut(s)	281, 711
FatI	CATG	7 cut(s)	84, 216, 224, 421, 445, 597, 634
FbaI	TGATCA	1 cut(s)	517
Fnu4HI	GCNGC	2 cut(s)	578, 791
FokI	GGATG	3 cut(s)	88, 177, 681
Fsp4HI	GCNGC	2 cut(s)	578, 791
FspBI	CTAG	3 cut(s)	65, 282, 768
GluI	GCNGC	2 cut(s)	578, 791
HaeIII	GGCC	3 cut(s)	60, 420, 674
HapII	CCGG	2 cut(s)	349, 494
Hin1II	CATG	7 cut(s)	88, 220, 228, 425, 449, 601, 638
HincII	GTYRAC	1 cut(s)	165
HindII	GTYRAC	1 cut(s)	165
HinfI	GANTC	6 cut(s)	80, 506, 605, 617, 703, 716
HpaII	CCGG	2 cut(s)	349, 494
HphI	GGTGA	2 cut(s)	146, 383
Hpy166II	GTNNAC	2 cut(s)	165, 374
Hpy188III	TCNNGA	4 cut(s)	146, 197, 437, 446
Hpy8I	GTNNAC	2 cut(s)	165, 374
Hpy99I	CGWCG	1 cut(s)	53
HpyAV	CCTTC	1 cut(s)	544
HpyCH4III	ACNGT	3 cut(s)	473, 589, 733
HpyCH4IV	ACGT	1 cut(s)	796
HpyCH4V	TGCA	2 cut(s)	295, 580
HpyF10VI	GCNNNNNNNGC	1 cut(s)	530
HpyF3I	CTNAG	2 cut(s)	480, 534
HpySE526I	ACGT	1 cut(s)	796
Hsp92II	CATG	7 cut(s)	88, 220, 228, 425, 449, 601, 638
Ksp22I	TGATCA	1 cut(s)	517
Kzo9I	GATC	7 cut(s)	33, 299, 310, 391, 517, 541, 764
LmnI	GCTCC	2 cut(s)	124, 496
Lsp1109I	GCAGC	1 cut(s)	564
MaeI	CTAG	3 cut(s)	65, 282, 768
MaeII	ACGT	1 cut(s)	796
MaeIII	GTNAC	1 cut(s)	727
MalI	GATC	7 cut(s)	35, 301, 312, 393, 519, 543, 766
MboI	GATC	7 cut(s)	33, 299, 310, 391, 517, 541, 764
MboII	GAAGA	6 cut(s)	35, 386, 425, 551, 771, 774
MfeI	CAATTG	1 cut(s)	271
MflI	RGATCY	5 cut(s)	33, 299, 391, 541, 764
MlsI	TGGCCA	1 cut(s)	60
MluCI	AATT	6 cut(s)	149, 173, 207, 244, 271, 463
MluNI	TGGCCA	1 cut(s)	60
MlyI	GAGTC	2 cut(s)	697, 725
Mox20I	TGGCCA	1 cut(s)	60
MscI	TGGCCA	1 cut(s)	60
MseI	TTAA	2 cut(s)	645, 753
MslI	CAYNNNNRTG	1 cut(s)	450
Msp20I	TGGCCA	1 cut(s)	60
MspA1I	CMGCKG	2 cut(s)	533, 577
MspI	CCGG	2 cut(s)	349, 494
MspR9I	CCNGG	2 cut(s)	107, 695
MunI	CAATTG	1 cut(s)	271
Mva1269I	GAATGC	1 cut(s)	141
MvaI	CCWGG	2 cut(s)	107, 695
MwoI	GCNNNNNNNGC	1 cut(s)	530
NcoI	CCATGG	1 cut(s)	84
NdeII	GATC	7 cut(s)	33, 299, 310, 391, 517, 541, 764
NlaIII	CATG	7 cut(s)	88, 220, 228, 425, 449, 601, 638
NlaIV	GGNNCC	4 cut(s)	90, 111, 492, 555
NmuCI	GTSAC	1 cut(s)	727
NspI	RCATGY	1 cut(s)	638
PagI	TCATGA	1 cut(s)	445
PasI	CCCWGGG	1 cut(s)	694
PciI	ACATGT	1 cut(s)	634
PctI	GAATGC	1 cut(s)	141
PfeI	GAWTC	4 cut(s)	80, 506, 605, 617
PinAI	ACCGGT	1 cut(s)	348
PkrI	GCNGC	2 cut(s)	579, 792
PleI	GAGTC	2 cut(s)	697, 724
PmaCI	CACGTG	1 cut(s)	797
PmlI	CACGTG	1 cut(s)	797
PpsI	GAGTC	2 cut(s)	697, 724
Ppu21I	YACGTR	1 cut(s)	797
PscI	ACATGT	1 cut(s)	634
PshAI	GACNNNNGTC	1 cut(s)	734
Psp6I	CCWGG	2 cut(s)	105, 693
PspCI	CACGTG	1 cut(s)	797
PspGI	CCWGG	2 cut(s)	105, 693
PspN4I	GGNNCC	4 cut(s)	90, 111, 492, 555
PspPI	GGNCC	2 cut(s)	418, 672
PstI	CTGCAG	1 cut(s)	297
PsuI	RGATCY	5 cut(s)	33, 299, 391, 541, 764
PvuII	CAGCTG	2 cut(s)	533, 577
RsaI	GTAC	2 cut(s)	353, 642
RsaNI	GTAC	2 cut(s)	352, 641
RseI	CAYNNNNRTG	1 cut(s)	450
SaqAI	TTAA	2 cut(s)	645, 753
SatI	GCNGC	2 cut(s)	578, 791
Sau3AI	GATC	7 cut(s)	33, 299, 310, 391, 517, 541, 764
Sau96I	GGNCC	2 cut(s)	418, 672
SchI	GAGTC	2 cut(s)	697, 725
ScrFI	CCNGG	2 cut(s)	107, 695
SfcI	CTRYAG	2 cut(s)	114, 293
SmiMI	CAYNNNNRTG	1 cut(s)	450
Sse9I	AATT	6 cut(s)	149, 173, 207, 244, 271, 463
SsiI	CCGC	1 cut(s)	122
SspMI	CTAG	3 cut(s)	65, 282, 768
StyD4I	CCNGG	2 cut(s)	105, 693
StyI	CCWWGG	2 cut(s)	84, 592
TaaI	ACNGT	3 cut(s)	473, 589, 733
TaiI	ACGT	1 cut(s)	799
TaqI	TCGA	2 cut(s)	631, 760
TasI	AATT	6 cut(s)	149, 173, 207, 244, 271, 463
TatI	WGTACW	1 cut(s)	640
TfiI	GAWTC	4 cut(s)	80, 506, 605, 617
Tru1I	TTAA	2 cut(s)	645, 753
Tru9I	TTAA	2 cut(s)	645, 753
TscAI	CASTG	3 cut(s)	297, 478, 564
TseFI	GTSAC	1 cut(s)	727
TseI	GCWGC	2 cut(s)	577, 790
Tsp45I	GTSAC	1 cut(s)	727
TspDTI	ATGAA	5 cut(s)	176, 349, 391, 426, 434
TspRI	CASTG	3 cut(s)	297, 478, 564
XagI	CCTNNNNNAGG	1 cut(s)	201
XapI	RAATTY	4 cut(s)	149, 173, 207, 463
XceI	RCATGY	1 cut(s)	638
XcmI	CCANNNNNNNNNTGG	1 cut(s)	68
XspI	CTAG	3 cut(s)	65, 282, 768

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.