Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002380.1

Orthogroup ID

OG0007381

Physical Location & Seq

Genomic Coordinates Forward (+)

102978 .. 105898

Gene Structure 2921 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002380.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 2010 bp

atgaacgataagtcacagttgatgaatcaacccccaccgccgccgatgttgagtctgagccaagctcaagccatgagccagccgccgccgatgatggctcaaccgccgccgccgcagatgatggctccgtcttctcaagccatggctgctgctgctgctgctcagcagcaagtacagatgatgatgaacagtcaatctcagccgttgatgatgaaccggagctacaaggcttggccgccgcagcagcagcagcagcagcagcaacagttcgtcgccgcccagaagccgccgcagtcgaatctgggaaggaataattggaagggtaagaagggaaatgacaagcggagaatggagaaaaacgttcccaatttgcccctgagcggtggccaaagcagtagcggaggagggtataatgttcccaatttgcccctgagtggtggccagagcagcggaggaggcggaggagggtatatacctccgacgcttaacgagttacagtcacagaatcgaatgaaagctcggaaattttaccccaaaaagaagtttaacaataggtttgcgccttacgccccaaggaacacgacgtcgtttatcattagagctaagaagtccggtgggattgcttcgctggtttcgccttgtccggtgacccctgccgtgctccccacgcccattttctcgccgtcgagggaggttttgggggacatggcgaaggaggagtggggtgtggatgggtatgggtcgatgaaagggttgattcggcttcggtctcccgggaatgaagatgatgaggagggagggggtgggtcgagtgagagtgatgtggaggagcatgtggaggtggagaggaggttggaccatgatctgagccggttcgagatgatatacccgaattacagtggggttgagtataataatgtgctggagaatagagtggatgatcaggatacacacattgctcagttggaggaagagaatttgactttgaaggagaggctgttcttgatggagagggagttgggggacttgaggaggaggatgttgtttcttgagaggaggcaccatgtgatggaggaggttaatgaggaggttgtggagaatgggtcggagaacgatagtgatggagggtcggatgtgccccatatgggcatagggggagagagcaacattgaggtggtagattatgtgtccagaaacggtgggtttggggatgtttcgatggaagaatatgtgcatggtgaaatgaatttaaaggaaaatgaggtcaaagatgaagtgagaaatgaggttgtaggtaatgaagagattgaacgtaagaacgagggaagaaggaatgaccttgtaggtgatggggtcgtttcagagaaggttgaggaagtgaggaatgagtttataatgaacaaagtaattgcaaataaaactgagctggtgagtagtgaagttgagacaaagaatgagaatgagtttatgcagggtcaggtgaacatagagaaggctgaagacatggtaattgcctgcaatgagaagaatgaaactaaagttatgagaaatgaagttgagaccaagcttgaaaatgagttgatgcgcggtcagatgaatgcagagaaggatgaagaaatggggacttcatgcacagaggataataagaccgagggtcaggtgaagaatgaagttgagacgaagaatgagagtgagttgatgcagggtcagatgaatgcacagagggatgaagaaatgggaattggcagcacagagaagagcattggcgtcggtctaagactgttttctccgtcgtcaagaagtccaaagattgagaagagaccagtacttgttttggacttcatcactgagcagacatgtttattgtatgaggaagctgcttcatccgctccatctgtgatcttccaaatctttggtttgctgcatggactccttcacaacagactcaaccatgtggctgtgggtaagaacgaggataatgctgcatttaggtttctctttttgacttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

669

Amino Acids

74.66

Weight (kDa)

4.99

Isoelectric Point (pI)

63.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007381)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G19900 AT5G19900 AT5G19900 AT5G19900 AT5G19900
fragaria_vesca	FvH4_3g44330 FvH4_3g44330
malus_domestica	MD03G1014800.v1.1 MD11G1016000.v1.1
prunus_persica	Prupe.6G014100_v2.0.a1
pyrus_communis	pycom03g01240 pycom11g01120
rosa_chinensis	RchiOBHm_Chr5g0080701
rosa_laevigata	RLG00000036887
rosa_multiflora	Rmu_sc0002380.1_g000013 Rmu_sc0027070.1_g000002
rosa_roxburghii	Rroxscaffold_1G00002720
rosa_rugosa	Rorug05G0471700 Rorug05G0471700
rosa_samantha	Rh5AG524800 Rh5BG546900 Rh5CG570300 Rh5DG557100
rosa_wichuraiana	Rw5G048670 Rw5G049240

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	1394
AatII	GACGTC	1 cut(s)	587
AccB1I	GGYRCC	1 cut(s)	1059
AccB7I	CCANNNNNTGG	1 cut(s)	1069
AccBSI	CCGCTC	2 cut(s)	381, 1889
AccII	CGCG	1 cut(s)	1587
AclI	AACGTT	1 cut(s)	360
AcoI	YGGCCR	3 cut(s)	233, 385, 439
AcsI	RAATTY	3 cut(s)	524, 976, 1246
AcuI	CTGAAG	1 cut(s)	1518
AcyI	GRCGYC	2 cut(s)	584, 1767
AdeI	CACNNNGTG	1 cut(s)	1066
AfaI	GTAC	2 cut(s)	174, 1827
AfiI	CCNNNNNNNGG	4 cut(s)	380, 434, 1069, 1145
AflIII	ACRYGT	1 cut(s)	1856
AgsI	TTSAA	3 cut(s)	988, 1310, 1571
AhdI	GACNNNNNGTC	1 cut(s)	1653
AjuI	GAANNNNNNNTTGG	4 cut(s)	298, 330, 1725, 1757
AloI	GAACNNNNNNTCC	2 cut(s)	983, 1015
AluBI	AGCT	7 cut(s)	65, 222, 518, 602, 1426, 1567, 1877
AluI	AGCT	7 cut(s)	65, 222, 518, 602, 1426, 1567, 1877
Alw21I	GWGCWC	1 cut(s)	663
Alw26I	GTCTC	5 cut(s)	774, 1439, 1553, 1670, 1813
Ama87I	CYCGRG	1 cut(s)	773
AoxI	GGCC	3 cut(s)	233, 385, 439
ApoI	RAATTY	3 cut(s)	524, 976, 1246
AspLEI	GCGC	2 cut(s)	562, 1587
AspS9I	GGNCC	1 cut(s)	856
AsuC2I	CCSGG	2 cut(s)	774, 775
AsuHPI	GGTGA	6 cut(s)	658, 1250, 1358, 1441, 1492, 1672
AvaI	CYCGRG	1 cut(s)	773
AvaII	GGWCC	1 cut(s)	856
BaeGI	GKGCMC	1 cut(s)	1140
BalI	TGGCCA	2 cut(s)	387, 441
BanI	GGYRCC	1 cut(s)	1059
BbsI	GAAGAC	2 cut(s)	123, 1506
Bbv12I	GWGCWC	1 cut(s)	663
BccI	CCATC	9 cut(s)	88, 115, 725, 1000, 1063, 1115, 1213, 1343, 1900
BceAI	ACGGC	3 cut(s)	187, 641, 667
BcgI	CGANNNNNNTGC	4 cut(s)	1750, 1784, 1961, 1995
BciVI	GTATCC	1 cut(s)	940
BclI	TGATCA	1 cut(s)	940
BcnI	CCSGG	2 cut(s)	774, 775
BcoDI	GTCTC	5 cut(s)	774, 1439, 1553, 1670, 1813
BfuI	GTATCC	1 cut(s)	940
BlpI	GCTNAGC	1 cut(s)	162
BmcAI	AGTACT	1 cut(s)	1827
Bme1390I	CCNGG	2 cut(s)	774, 775
Bme18I	GGWCC	1 cut(s)	856
BmeRI	GACNNNNNGTC	1 cut(s)	1653
BmeT110I	CYCGRG	1 cut(s)	773
BmgT120I	GGNCC	1 cut(s)	856
BmiI	GGNNCC	2 cut(s)	126, 1061
BmrFI	CCNGG	2 cut(s)	774, 775
BmsI	GCATC	2 cut(s)	1572, 1689
BpiI	GAAGAC	2 cut(s)	123, 1506
BplI	GAGNNNNNCTC	2 cut(s)	49, 81
BpmI	CTGGAG	1 cut(s)	944
Bpu10I	CCTNAGC	1 cut(s)	377
Bpu1102I	GCTNAGC	1 cut(s)	162
BpuEI	CTTGAG	4 cut(s)	51, 120, 1048, 1070
BpuMI	CCSGG	2 cut(s)	774, 775
BsaHI	GRCGYC	2 cut(s)	584, 1767
BsaI	GGTCTC	3 cut(s)	774, 1553, 1813
BsaJI	CCNNGG	4 cut(s)	141, 572, 773, 1650
BsaWI	WCCGGW	3 cut(s)	216, 611, 643
BsaXI	ACNNNNNCTCC	8 cut(s)	836, 866, 983, 1001, 1013, 1031, 1088, 1118
Bsc4I	CCNNNNNNNGG	4 cut(s)	380, 434, 1069, 1145
Bse118I	RCCGGY	1 cut(s)	870
Bse1I	ACTGG	1 cut(s)	1823
Bse3DI	GCAATG	2 cut(s)	954, 1525
BseDI	CCNNGG	4 cut(s)	141, 572, 773, 1650
BseGI	GGATG	8 cut(s)	736, 943, 1044, 1138, 1216, 1615, 1732, 1883
BseLI	CCNNNNNNNGG	4 cut(s)	380, 434, 1069, 1145
BseMI	GCAATG	2 cut(s)	954, 1525
BseMII	CTCAG	9 cut(s)	47, 176, 212, 368, 422, 857, 974, 1413, 1839
BseNI	ACTGG	1 cut(s)	1823
BseSI	GKGCMC	1 cut(s)	1140
Bsh1236I	CGCG	1 cut(s)	1587
BshFI	GGCC	3 cut(s)	235, 387, 441
BshNI	GGYRCC	1 cut(s)	1059
BsiHKAI	GWGCWC	1 cut(s)	663
BsiHKCI	CYCGRG	1 cut(s)	773
BsiSI	CCGG	5 cut(s)	217, 612, 644, 774, 871
BslFI	GGGAC	3 cut(s)	716, 1037, 1636
BslI	CCNNNNNNNGG	4 cut(s)	380, 434, 1069, 1145
BsmAI	GTCTC	5 cut(s)	774, 1439, 1553, 1670, 1813
BsmBI	CGTCTC	1 cut(s)	1670
BsmFI	GGGAC	3 cut(s)	716, 1037, 1636
BsmI	GAATGC	2 cut(s)	1603, 1720
BsnI	GGCC	3 cut(s)	235, 387, 441
Bso31I	GGTCTC	3 cut(s)	774, 1553, 1813
BsoBI	CYCGRG	1 cut(s)	773
Bsp1286I	GDGCHC	2 cut(s)	663, 1140
Bsp143I	GATC	3 cut(s)	862, 940, 1899
Bsp1720I	GCTNAGC	1 cut(s)	162
Bsp19I	CCATGG	1 cut(s)	141
BspANI	GGCC	3 cut(s)	235, 387, 441
BspCNI	CTCAG	9 cut(s)	48, 175, 211, 369, 423, 858, 973, 1414, 1840
BspFNI	CGCG	1 cut(s)	1587
BspLI	GGNNCC	2 cut(s)	126, 1061
BspQI	GCTCTTC	1 cut(s)	1751
BspT107I	GGYRCC	1 cut(s)	1059
BspTNI	GGTCTC	3 cut(s)	774, 1553, 1813
BsrBI	CCGCTC	2 cut(s)	381, 1889
BsrDI	GCAATG	2 cut(s)	954, 1525
BsrFI	RCCGGY	1 cut(s)	870
BsrI	ACTGG	1 cut(s)	1823
BssAI	RCCGGY	1 cut(s)	870
BssECI	CCNNGG	4 cut(s)	141, 572, 773, 1650
BssMI	GATC	3 cut(s)	862, 940, 1899
BssNI	GRCGYC	2 cut(s)	584, 1767
BssT1I	CCWWGG	2 cut(s)	141, 572
Bst4CI	ACNGT	7 cut(s)	18, 191, 267, 498, 899, 1199, 1782
Bst6I	CTCTTC	4 cut(s)	966, 1296, 1751, 1811
BstACI	GRCGYC	2 cut(s)	584, 1767
BstC8I	GCNNGC	2 cut(s)	80, 1516
BstDSI	CCRYGG	1 cut(s)	141
BstEII	GGTNACC	1 cut(s)	646
BstF5I	GGATG	8 cut(s)	736, 943, 1044, 1138, 1216, 1615, 1732, 1883
BstFNI	CGCG	1 cut(s)	1587
BstHHI	GCGC	2 cut(s)	562, 1587
BstKTI	GATC	3 cut(s)	865, 943, 1902
BstMAI	GTCTC	5 cut(s)	774, 1439, 1553, 1670, 1813
BstMBI	GATC	3 cut(s)	862, 940, 1899
BstNSI	RCATGY	2 cut(s)	836, 1860
BstPI	GGTNACC	1 cut(s)	646
BstSCI	CCNGG	2 cut(s)	772, 773
BstSLI	GKGCMC	1 cut(s)	1140
BstUI	CGCG	1 cut(s)	1587
BstV2I	GAAGAC	2 cut(s)	123, 1506
BstXI	CCANNNNNNTGG	1 cut(s)	1913
BsuI	GTATCC	1 cut(s)	940
BsuRI	GGCC	3 cut(s)	235, 387, 441
BtgI	CCRYGG	1 cut(s)	141
BtsCI	GGATG	8 cut(s)	736, 943, 1044, 1138, 1216, 1615, 1732, 1883
BtsIMutI	CAGTG	2 cut(s)	904, 1845
Cac8I	GCNNGC	2 cut(s)	80, 1516
CfoI	GCGC	2 cut(s)	562, 1587
Cfr10I	RCCGGY	1 cut(s)	870
Cfr13I	GGNCC	1 cut(s)	856
Cfr9I	CCCGGG	1 cut(s)	773
CseI	GACGC	2 cut(s)	490, 1756
Csp6I	GTAC	2 cut(s)	173, 1826
CviQI	GTAC	2 cut(s)	173, 1826
DpnI	GATC	3 cut(s)	864, 942, 1901
DpnII	GATC	3 cut(s)	862, 940, 1899
DraI	TTTAAA	1 cut(s)	1251
DraIII	CACNNNGTG	1 cut(s)	1066
DriI	GACNNNNNGTC	1 cut(s)	1653
EaeI	YGGCCR	3 cut(s)	233, 385, 439
Eam1104I	CTCTTC	4 cut(s)	966, 1296, 1751, 1811
Eam1105I	GACNNNNNGTC	1 cut(s)	1653
EarI	CTCTTC	4 cut(s)	966, 1296, 1751, 1811
EciI	GGCGGA	1 cut(s)	474
Eco130I	CCWWGG	2 cut(s)	141, 572
Eco31I	GGTCTC	3 cut(s)	774, 1553, 1813
Eco47I	GGWCC	1 cut(s)	856
Eco57I	CTGAAG	1 cut(s)	1518
Eco88I	CYCGRG	1 cut(s)	773
Eco91I	GGTNACC	1 cut(s)	646
EcoO65I	GGTNACC	1 cut(s)	646
EcoT14I	CCWWGG	2 cut(s)	141, 572
ErhI	CCWWGG	2 cut(s)	141, 572
Esp3I	CGTCTC	1 cut(s)	1670
FaqI	GGGAC	3 cut(s)	716, 1037, 1636
FauNDI	CATATG	1 cut(s)	1143
FbaI	TGATCA	1 cut(s)	940
FokI	GGATG	8 cut(s)	743, 950, 1051, 1145, 1223, 1622, 1739, 1870
GlaI	GCGC	2 cut(s)	561, 1586
GsuI	CTGGAG	1 cut(s)	944
HaeIII	GGCC	3 cut(s)	235, 387, 441
HapII	CCGG	5 cut(s)	217, 612, 644, 774, 871
HgaI	GACGC	2 cut(s)	490, 1756
HhaI	GCGC	2 cut(s)	562, 1587
Hin1I	GRCGYC	2 cut(s)	584, 1767
Hin6I	GCGC	2 cut(s)	560, 1585
HinP1I	GCGC	2 cut(s)	560, 1585
HindIII	AAGCTT	1 cut(s)	1565
HinfI	GANTC	7 cut(s)	25, 52, 298, 505, 757, 1929, 1944
HpaII	CCGG	5 cut(s)	217, 612, 644, 774, 871
HphI	GGTGA	6 cut(s)	658, 1250, 1358, 1441, 1492, 1672
Hpy166II	GTNNAC	1 cut(s)	1483
Hpy188I	TCNGA	9 cut(s)	57, 480, 522, 867, 1108, 1132, 1363, 1593, 1710
Hpy188III	TCNNGA	6 cut(s)	877, 944, 1003, 1049, 1191, 1797
Hpy8I	GTNNAC	1 cut(s)	1483
Hpy99I	CGWCG	7 cut(s)	275, 484, 586, 589, 688, 1772, 1795
HpyCH4III	ACNGT	7 cut(s)	18, 191, 267, 498, 899, 1199, 1782
HpyCH4IV	ACGT	3 cut(s)	360, 584, 1312
HpySE526I	ACGT	3 cut(s)	360, 584, 1312
Hsp92I	GRCGYC	2 cut(s)	584, 1767
HspAI	GCGC	2 cut(s)	560, 1585
Ksp22I	TGATCA	1 cut(s)	940
Kzo9I	GATC	3 cut(s)	862, 940, 1899
LguI	GCTCTTC	1 cut(s)	1751
LmnI	GCTCC	5 cut(s)	130, 219, 666, 829, 1894
LweI	GCATC	2 cut(s)	1572, 1689
MaeII	ACGT	3 cut(s)	360, 584, 1312
MaeIII	GTNAC	4 cut(s)	12, 492, 498, 646
MalI	GATC	3 cut(s)	864, 942, 1901
MbiI	CCGCTC	2 cut(s)	381, 1889
MboI	GATC	3 cut(s)	862, 940, 1899
MhlI	GDGCHC	2 cut(s)	663, 1140
MlsI	TGGCCA	2 cut(s)	387, 441
MluNI	TGGCCA	2 cut(s)	387, 441
MlyI	GAGTC	3 cut(s)	61, 1923, 1938
MmeI	TCCRAC	5 cut(s)	503, 834, 945, 1086, 1110
Mox20I	TGGCCA	2 cut(s)	387, 441
MscI	TGGCCA	2 cut(s)	387, 441
MseI	TTAA	4 cut(s)	486, 546, 1080, 1250
MslI	CAYNNNNRTG	1 cut(s)	1172
Msp20I	TGGCCA	2 cut(s)	387, 441
MspA1I	CMGCKG	1 cut(s)	450
MspI	CCGG	5 cut(s)	217, 612, 644, 774, 871
MspR9I	CCNGG	2 cut(s)	774, 775
Mva1269I	GAATGC	2 cut(s)	1603, 1720
MvnI	CGCG	1 cut(s)	1587
NciI	CCSGG	2 cut(s)	774, 775
NcoI	CCATGG	1 cut(s)	141
NdeI	CATATG	1 cut(s)	1143
NdeII	GATC	3 cut(s)	862, 940, 1899
NlaIV	GGNNCC	2 cut(s)	126, 1061
NmuCI	GTSAC	3 cut(s)	12, 498, 646
NspI	RCATGY	2 cut(s)	836, 1860
PciI	ACATGT	1 cut(s)	1856
PciSI	GCTCTTC	1 cut(s)	1751
PctI	GAATGC	2 cut(s)	1603, 1720
PfeI	GAWTC	4 cut(s)	25, 298, 505, 757
PflMI	CCANNNNNTGG	1 cut(s)	1069
PleI	GAGTC	3 cut(s)	60, 1923, 1938
PpsI	GAGTC	3 cut(s)	60, 1923, 1938
PscI	ACATGT	1 cut(s)	1856
PsiI	TTATAA	1 cut(s)	1394
Psp1406I	AACGTT	1 cut(s)	360
PspEI	GGTNACC	1 cut(s)	646
PspN4I	GGNNCC	2 cut(s)	126, 1061
PspPI	GGNCC	1 cut(s)	856
PsrI	GAACNNNNNNTAC	2 cut(s)	206, 238
RsaI	GTAC	2 cut(s)	174, 1827
RsaNI	GTAC	2 cut(s)	173, 1826
RseI	CAYNNNNRTG	1 cut(s)	1172
SapI	GCTCTTC	1 cut(s)	1751
SaqAI	TTAA	4 cut(s)	486, 546, 1080, 1250
Sau3AI	GATC	3 cut(s)	862, 940, 1899
Sau96I	GGNCC	1 cut(s)	856
ScaI	AGTACT	1 cut(s)	1827
SchI	GAGTC	3 cut(s)	61, 1923, 1938
ScrFI	CCNGG	2 cut(s)	774, 775
SduI	GDGCHC	2 cut(s)	663, 1140
SfaNI	GCATC	2 cut(s)	1572, 1689
SinI	GGWCC	1 cut(s)	856
SmaI	CCCGGG	1 cut(s)	775
SmiMI	CAYNNNNRTG	1 cut(s)	1172
SmlI	CTYRAG	4 cut(s)	66, 135, 1027, 1049
SmoI	CTYRAG	4 cut(s)	66, 135, 1027, 1049
StyD4I	CCNGG	2 cut(s)	772, 773
StyI	CCWWGG	2 cut(s)	141, 572
TaaI	ACNGT	7 cut(s)	18, 191, 267, 498, 899, 1199, 1782
TaiI	ACGT	3 cut(s)	363, 587, 1315
TaqI	TCGA	7 cut(s)	296, 508, 686, 743, 809, 876, 1217
TaqII	GACCGA	3 cut(s)	756, 1664, 1760
TatI	WGTACW	2 cut(s)	172, 1825
TfiI	GAWTC	4 cut(s)	25, 298, 505, 757
Tru1I	TTAA	4 cut(s)	486, 546, 1080, 1250
Tru9I	TTAA	4 cut(s)	486, 546, 1080, 1250
TscAI	CASTG	2 cut(s)	904, 1852
TseFI	GTSAC	3 cut(s)	12, 498, 646
Tsp45I	GTSAC	3 cut(s)	12, 498, 646
TspGWI	ACGGA	2 cut(s)	117, 1779
TspMI	CCCGGG	1 cut(s)	773
TspRI	CASTG	2 cut(s)	904, 1852
Van91I	CCANNNNNTGG	1 cut(s)	1069
VpaK11BI	GGWCC	1 cut(s)	856
XapI	RAATTY	3 cut(s)	524, 976, 1246
XceI	RCATGY	2 cut(s)	836, 1860
XmaI	CCCGGG	1 cut(s)	773
ZraI	GACGTC	1 cut(s)	585
ZrmI	AGTACT	1 cut(s)	1827

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.