Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002508.1

Orthogroup ID

OG0004095

Physical Location & Seq

Genomic Coordinates Reverse (-)

158059 .. 158814

Gene Structure 756 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002508.1_g000038.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 756 bp

atgagagtcatcattattgatacctggggacatgaattcaccatagaggtgggtctgaaagaacctgttcttgaaatcaaaaggaaggtggaacaactcttgggcatcccagcagctgcacaaacccttgcagtatctgaatgggagttagaagatggactagacatggaagactatccaattgtcactgaaggtacgaaaattgacctcaccatcaaatgcatggaacctcatgtaaaccagtccactcagattcagattatcgtaaaatcttcagcaacacagcatcagttagaggtattcagaacagagacagttggtagcctaaaagaaaaaatccacattattgacggtacaccgatcaaaagaatgtcactcatcttttctggaattgagttggaagaagattttcgcaaattaagtgagtatgggatatgtgaattttctgagatcgctttgttcctcaagaccatgaattgtctcagagacagccctccgtccagaagattgagtatagtggtacaaacttcctcaagtttacttaattcagcaagtattcctttgaaaatggaggattcaagcacagttaatgacttgaggcagttacttttgagcagtaaatttcttcctgctgatgattatttgttcatacacaagcaaaggaccatgcgtgacaattgtagcctcaagtggcatggtgtagaagatggagattctatatatgtatttaaagggactgtctatcgcagtggataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03320 map03320

Pfam Domains

Protein Families

ubiquitin

Protein Analysis

251

Amino Acids

28.46

Weight (kDa)

5.25

Isoelectric Point (pI)

45.68

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004095)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G32350
fragaria_vesca	FvH4_6g26390 FvH4_6g43480
malus_domestica	MD01G1026100.v1.1 MD09G1246300.v1.1 MD17G1239100.v1.1
prunus_persica	Prupe.3G131400_v2.0.a1 Prupe.3G219500_v2.0.a1
pyrus_communis	pycom01g05440
rosa_chinensis	RchiOBHm_Chr2g0159951
rosa_laevigata	RLG00000018925 RLG00000021187 RLG00000036498
rosa_multiflora	Rmu_sc0000007.1_g000027 Rmu_sc0000909.1_g000026 Rmu_sc0002508.1_g000038 Rmu_sc0012797.1_g000001
rosa_roxburghii	Rroxscaffold_2G00090130
rosa_rugosa	Rorug02G0270000 Rorug02G0479400
rosa_samantha	Rh2AG322200 Rh2AG546000 Rh2BG330400 Rh2BG559300 Rh2CG310300 Rh2CG529400 Rh2DG349700 Rh2DG568000 Rh5BG512100 Rh5CG535800
rosa_wichuraiana	Rw2G026130 Rw2G045160 Rw5G045470

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	3 cut(s)	35, 440, 620
AcuI	CTGAAG	2 cut(s)	210, 258
AfaI	GTAC	3 cut(s)	196, 355, 522
AgsI	TTSAA	3 cut(s)	74, 565, 579
AjnI	CCWGG	1 cut(s)	23
AluBI	AGCT	1 cut(s)	116
AluI	AGCT	1 cut(s)	116
Alw26I	GTCTC	3 cut(s)	305, 480, 485
AlwNI	CAGNNNCTG	2 cut(s)	116, 137
ApeKI	GCWGC	2 cut(s)	113, 116
ApoI	RAATTY	3 cut(s)	35, 440, 620
Asp700I	GAANNNNTTC	2 cut(s)	66, 408
AspS9I	GGNCC	1 cut(s)	663
AsuHPI	GGTGA	2 cut(s)	31, 202
AvaII	GGWCC	1 cut(s)	663
BbsI	GAAGAC	1 cut(s)	177
BbvI	GCAGC	2 cut(s)	103, 125
BccI	CCATC	3 cut(s)	149, 221, 701
BciT130I	CCWGG	1 cut(s)	25
BcoDI	GTCTC	3 cut(s)	305, 480, 485
BfaI	CTAG	1 cut(s)	161
BisI	GCNGC	2 cut(s)	114, 117
BlsI	GCNGC	2 cut(s)	115, 118
Bme1390I	CCNGG	1 cut(s)	25
Bme18I	GGWCC	1 cut(s)	663
BmgT120I	GGNCC	1 cut(s)	663
BmiI	GGNNCC	1 cut(s)	228
BmrFI	CCNGG	1 cut(s)	25
BmsI	GCATC	2 cut(s)	114, 295
BpiI	GAAGAC	1 cut(s)	177
BpuEI	CTTGAG	4 cut(s)	449, 517, 616, 671
BsaJI	CCNNGG	1 cut(s)	24
Bse1I	ACTGG	1 cut(s)	241
BseBI	CCWGG	1 cut(s)	25
BseDI	CCNNGG	1 cut(s)	24
BseGI	GGATG	1 cut(s)	105
BseMII	CTCAG	3 cut(s)	263, 438, 496
BseNI	ACTGG	1 cut(s)	241
BseXI	GCAGC	2 cut(s)	103, 125
BseYI	CCCAGC	1 cut(s)	109
BsgI	GTGCAG	1 cut(s)	102
BslFI	GGGAC	2 cut(s)	42, 748
BsmAI	GTCTC	3 cut(s)	305, 480, 485
BsmFI	GGGAC	2 cut(s)	42, 748
Bsp143I	GATC	2 cut(s)	360, 450
BspCNI	CTCAG	3 cut(s)	262, 439, 495
BspLI	GGNNCC	1 cut(s)	228
BsrI	ACTGG	1 cut(s)	241
BssECI	CCNNGG	1 cut(s)	24
BssMI	GATC	2 cut(s)	360, 450
Bst2UI	CCWGG	1 cut(s)	25
Bst4CI	ACNGT	4 cut(s)	316, 353, 586, 739
BstDEI	CTNAG	3 cut(s)	249, 447, 482
BstF5I	GGATG	1 cut(s)	105
BstKTI	GATC	2 cut(s)	363, 453
BstMAI	GTCTC	3 cut(s)	305, 480, 485
BstMBI	GATC	2 cut(s)	360, 450
BstNI	CCWGG	1 cut(s)	25
BstSCI	CCNGG	1 cut(s)	23
BstV1I	GCAGC	2 cut(s)	103, 125
BstV2I	GAAGAC	1 cut(s)	177
BstXI	CCANNNNNNTGG	1 cut(s)	49
BtsCI	GGATG	1 cut(s)	105
BtsI	GCAGTG	1 cut(s)	754
BtsIMutI	CAGTG	2 cut(s)	186, 754
CaiI	CAGNNNCTG	2 cut(s)	116, 137
Cfr13I	GGNCC	1 cut(s)	663
Csp6I	GTAC	3 cut(s)	195, 354, 521
CviAII	CATG	7 cut(s)	32, 166, 223, 233, 472, 667, 695
CviJI	RGCY	4 cut(s)	116, 324, 492, 684
CviKI_1	RGCY	4 cut(s)	116, 324, 492, 684
CviQI	GTAC	3 cut(s)	195, 354, 521
DdeI	CTNAG	3 cut(s)	249, 447, 482
DpnI	GATC	2 cut(s)	362, 452
DpnII	GATC	2 cut(s)	360, 450
DraI	TTTAAA	1 cut(s)	730
Eco47I	GGWCC	1 cut(s)	663
Eco57I	CTGAAG	2 cut(s)	210, 258
EcoRI	GAATTC	1 cut(s)	35
EcoRII	CCWGG	1 cut(s)	23
EcoT22I	ATGCAT	1 cut(s)	224
FaeI	CATG	7 cut(s)	35, 169, 226, 236, 475, 670, 698
FalI	AAGNNNNNCTT	2 cut(s)	544, 576
FaqI	GGGAC	2 cut(s)	42, 748
FatI	CATG	7 cut(s)	31, 165, 222, 232, 471, 666, 694
Fnu4HI	GCNGC	2 cut(s)	114, 117
FokI	GGATG	1 cut(s)	92
Fsp4HI	GCNGC	2 cut(s)	114, 117
FspBI	CTAG	1 cut(s)	161
GluI	GCNGC	2 cut(s)	114, 117
GsaI	CCCAGC	1 cut(s)	113
Hin1II	CATG	7 cut(s)	35, 169, 226, 236, 475, 670, 698
HinfI	GANTC	4 cut(s)	6, 253, 575, 713
HphI	GGTGA	2 cut(s)	31, 202
Hpy166II	GTNNAC	4 cut(s)	238, 246, 356, 539
Hpy188I	TCNGA	7 cut(s)	57, 139, 252, 258, 305, 448, 485
Hpy188III	TCNNGA	4 cut(s)	71, 387, 466, 501
Hpy8I	GTNNAC	4 cut(s)	238, 246, 356, 539
HpyAV	CCTTC	2 cut(s)	79, 185
HpyCH4III	ACNGT	4 cut(s)	316, 353, 586, 739
HpyCH4V	TGCA	3 cut(s)	119, 131, 222
HpyF3I	CTNAG	3 cut(s)	249, 447, 482
Hsp92II	CATG	7 cut(s)	35, 169, 226, 236, 475, 670, 698
Kzo9I	GATC	2 cut(s)	360, 450
LpnPI	CCDG	8 cut(s)	10, 37, 78, 123, 254, 372, 514, 642
Lsp1109I	GCAGC	2 cut(s)	103, 125
LweI	GCATC	2 cut(s)	114, 295
MaeI	CTAG	1 cut(s)	161
MaeIII	GTNAC	4 cut(s)	184, 372, 603, 671
MalI	GATC	2 cut(s)	362, 452
MboI	GATC	2 cut(s)	360, 450
MboII	GAAGA	8 cut(s)	164, 182, 264, 413, 416, 516, 617, 716
MfeI	CAATTG	2 cut(s)	180, 676
MlyI	GAGTC	1 cut(s)	15
MmeI	TCCRAC	1 cut(s)	378
Mph1103I	ATGCAT	1 cut(s)	224
MroXI	GAANNNNTTC	2 cut(s)	66, 408
MseI	TTAA	4 cut(s)	419, 543, 588, 729
MslI	CAYNNNNRTG	1 cut(s)	47
MspA1I	CMGCKG	1 cut(s)	116
MspR9I	CCNGG	1 cut(s)	25
MunI	CAATTG	2 cut(s)	180, 676
MvaI	CCWGG	1 cut(s)	25
NdeII	GATC	2 cut(s)	360, 450
NlaIII	CATG	7 cut(s)	35, 169, 226, 236, 475, 670, 698
NlaIV	GGNNCC	1 cut(s)	228
NmuCI	GTSAC	3 cut(s)	184, 372, 671
NsiI	ATGCAT	1 cut(s)	224
PdmI	GAANNNNTTC	2 cut(s)	66, 408
PfeI	GAWTC	3 cut(s)	253, 575, 713
PkrI	GCNGC	2 cut(s)	115, 118
PleI	GAGTC	1 cut(s)	14
PpsI	GAGTC	1 cut(s)	14
Psp6I	CCWGG	1 cut(s)	23
PspFI	CCCAGC	1 cut(s)	109
PspGI	CCWGG	1 cut(s)	23
PspN4I	GGNNCC	1 cut(s)	228
PspPI	GGNCC	1 cut(s)	663
PstNI	CAGNNNCTG	2 cut(s)	116, 137
PvuII	CAGCTG	1 cut(s)	116
RsaI	GTAC	3 cut(s)	196, 355, 522
RsaNI	GTAC	3 cut(s)	195, 354, 521
RseI	CAYNNNNRTG	1 cut(s)	47
SaqAI	TTAA	4 cut(s)	419, 543, 588, 729
SatI	GCNGC	2 cut(s)	114, 117
Sau3AI	GATC	2 cut(s)	360, 450
Sau96I	GGNCC	1 cut(s)	663
SchI	GAGTC	1 cut(s)	15
ScrFI	CCNGG	1 cut(s)	25
SetI	ASST	9 cut(s)	26, 51, 67, 90, 118, 196, 210, 232, 300
SfaNI	GCATC	2 cut(s)	114, 295
SinI	GGWCC	1 cut(s)	663
SmiMI	CAYNNNNRTG	1 cut(s)	47
SmlI	CTYRAG	4 cut(s)	464, 532, 595, 686
SmoI	CTYRAG	4 cut(s)	464, 532, 595, 686
SspMI	CTAG	1 cut(s)	161
StyD4I	CCNGG	1 cut(s)	23
TaaI	ACNGT	4 cut(s)	316, 353, 586, 739
TfiI	GAWTC	3 cut(s)	253, 575, 713
Tru1I	TTAA	4 cut(s)	419, 543, 588, 729
Tru9I	TTAA	4 cut(s)	419, 543, 588, 729
TscAI	CASTG	2 cut(s)	193, 754
TseFI	GTSAC	3 cut(s)	184, 372, 671
TseI	GCWGC	2 cut(s)	113, 116
Tsp45I	GTSAC	3 cut(s)	184, 372, 671
TspDTI	ATGAA	3 cut(s)	48, 488, 637
TspGWI	ACGGA	1 cut(s)	486
TspRI	CASTG	2 cut(s)	193, 754
VpaK11BI	GGWCC	1 cut(s)	663
XapI	RAATTY	3 cut(s)	35, 440, 620
XcmI	CCANNNNNNNNNTGG	1 cut(s)	220
XmnI	GAANNNNTTC	2 cut(s)	66, 408
XspI	CTAG	1 cut(s)	161
Zsp2I	ATGCAT	1 cut(s)	224

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.