Rw5G045470

Ubiquitin-like domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
OG0004095
Physical Location & Seq
Forward (+)
79487528 .. 79488043
516 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G045470.1

Sequence Viewer

Length: 516 bp
ATGATCATAAAATCTACAGCAACACAGCATCAGCTAGAGGTATTCAGAACAGAGACAGTTGGTAGCCTAAAAGAAAAAATCCACACTATTGACGGTACACCGATCAAAAGAATGTCACTCTTCTTTTCAGGAATTGAGTTGGAAGAAGATTTTCGCAAATTAAGTGAGTATGGGATATGTGAATTTTCTGAGATCGCTTTGTTCCTCAAGACCATGAATTATCTCAAAGACGGCCCACCGTCCAGAAGATTGAGTATAGTGGTACAAACTTCCTTGAGTTTACTTAATTCAGCAAGTATTCCTTTGAAAATGGAGGATGCAAGCACAGTTAATGACTTGAGGCAGTTACTTTTGAGCAGTAAATTTCTTCCTGCTGATGATTATTTGTTCATAAACAAGCAGAGGACCATGCGTGACAATTGTAGCCTCAAGTGGCATGGTGTAGAAGATGGAGATCTATATATGTATTTAAAGGGACTGTCTATCGCAGTGGATACTAATACTCAGGAAGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03320 map03320
Pfam Domains
Protein Families
ubiquitin

Protein Analysis

171

Amino Acids

19.5

Weight (kDa)

5.46

Isoelectric Point (pI)

37.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 3 - 70 8.8e-13 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 182, 362
AfaI GTAC 2 cut(s) 97, 264
AgsI TTSAA 1 cut(s) 307
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
Alw26I GTCTC 1 cut(s) 47
AoxI GGCC 1 cut(s) 232
ApoI RAATTY 2 cut(s) 182, 362
Asp700I GAANNNNTTC 1 cut(s) 150
AspS9I GGNCC 2 cut(s) 233, 405
AvaII GGWCC 1 cut(s) 405
BccI CCATC 1 cut(s) 443
BceAI ACGGC 1 cut(s) 247
BciVI GTATCC 1 cut(s) 487
BclI TGATCA 1 cut(s) 3
BcoDI GTCTC 1 cut(s) 47
BfaI CTAG 1 cut(s) 35
BfmI CTRYAG 1 cut(s) 15
BfuI GTATCC 1 cut(s) 487
BglII AGATCT 1 cut(s) 454
Bme18I GGWCC 1 cut(s) 405
BmgT120I GGNCC 2 cut(s) 233, 405
BmsI GCATC 2 cut(s) 37, 307
BpuEI CTTGAG 4 cut(s) 191, 295, 358, 413
BsaBI GATNNNNATC 1 cut(s) 453
Bse8I GATNNNNATC 1 cut(s) 453
BseGI GGATG 1 cut(s) 322
BseJI GATNNNNATC 1 cut(s) 453
BseMII CTCAG 1 cut(s) 180
BshFI GGCC 1 cut(s) 234
BslFI GGGAC 1 cut(s) 489
BsmAI GTCTC 1 cut(s) 47
BsmFI GGGAC 1 cut(s) 489
BsnI GGCC 1 cut(s) 234
Bsp143I GATC 4 cut(s) 3, 102, 192, 454
BspANI GGCC 1 cut(s) 234
BspCNI CTCAG 1 cut(s) 181
BssMI GATC 4 cut(s) 3, 102, 192, 454
Bst4CI ACNGT 5 cut(s) 58, 95, 240, 328, 480
Bst6I CTCTTC 2 cut(s) 125, 504
BstC8I GCNNGC 1 cut(s) 322
BstDEI CTNAG 2 cut(s) 189, 504
BstF5I GGATG 1 cut(s) 322
BstKTI GATC 4 cut(s) 6, 105, 195, 457
BstMAI GTCTC 1 cut(s) 47
BstMBI GATC 4 cut(s) 3, 102, 192, 454
BstSFI CTRYAG 1 cut(s) 15
BstX2I RGATCY 1 cut(s) 454
BstYI RGATCY 1 cut(s) 454
BsuI GTATCC 1 cut(s) 487
BsuRI GGCC 1 cut(s) 234
BtsCI GGATG 1 cut(s) 322
BtsI GCAGTG 1 cut(s) 495
BtsIMutI CAGTG 1 cut(s) 495
Cac8I GCNNGC 1 cut(s) 322
Cfr13I GGNCC 2 cut(s) 233, 405
Csp6I GTAC 2 cut(s) 96, 263
CviAII CATG 3 cut(s) 214, 409, 437
CviJI RGCY 4 cut(s) 34, 66, 234, 426
CviKI_1 RGCY 4 cut(s) 34, 66, 234, 426
CviQI GTAC 2 cut(s) 96, 263
DdeI CTNAG 2 cut(s) 189, 504
DpnI GATC 4 cut(s) 5, 104, 194, 456
DpnII GATC 4 cut(s) 3, 102, 192, 454
DraI TTTAAA 1 cut(s) 471
Eam1104I CTCTTC 2 cut(s) 125, 504
EarI CTCTTC 2 cut(s) 125, 504
Eco47I GGWCC 1 cut(s) 405
FaeI CATG 3 cut(s) 217, 412, 440
FalI AAGNNNNNCTT 2 cut(s) 286, 318
FaqI GGGAC 1 cut(s) 489
FatI CATG 3 cut(s) 213, 408, 436
FbaI TGATCA 1 cut(s) 3
FokI GGATG 1 cut(s) 329
FspBI CTAG 1 cut(s) 35
HaeIII GGCC 1 cut(s) 234
Hin1II CATG 3 cut(s) 217, 412, 440
Hpy166II GTNNAC 2 cut(s) 98, 281
Hpy188I TCNGA 2 cut(s) 47, 190
Hpy188III TCNNGA 4 cut(s) 129, 208, 243, 506
Hpy8I GTNNAC 2 cut(s) 98, 281
HpyCH4III ACNGT 5 cut(s) 58, 95, 240, 328, 480
HpyCH4V TGCA 1 cut(s) 320
HpyF3I CTNAG 2 cut(s) 189, 504
Hsp92II CATG 3 cut(s) 217, 412, 440
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 4 cut(s) 3, 102, 192, 454
LpnPI CCDG 4 cut(s) 114, 256, 384, 491
LweI GCATC 2 cut(s) 37, 307
MaeI CTAG 1 cut(s) 35
MaeIII GTNAC 3 cut(s) 114, 345, 413
MalI GATC 4 cut(s) 5, 104, 194, 456
MboI GATC 4 cut(s) 3, 102, 192, 454
MboII GAAGA 6 cut(s) 112, 155, 158, 258, 359, 458
MfeI CAATTG 1 cut(s) 418
MflI RGATCY 1 cut(s) 454
MluCI AATT 7 cut(s) 132, 158, 182, 217, 286, 362, 418
MmeI TCCRAC 1 cut(s) 120
MnlI CCTC 6 cut(s) 31, 215, 307, 333, 396, 437
MroXI GAANNNNTTC 1 cut(s) 150
MseI TTAA 4 cut(s) 161, 285, 330, 470
MunI CAATTG 1 cut(s) 418
NdeII GATC 4 cut(s) 3, 102, 192, 454
NlaIII CATG 3 cut(s) 217, 412, 440
NmuCI GTSAC 2 cut(s) 114, 413
PdmI GAANNNNTTC 1 cut(s) 150
PspPI GGNCC 2 cut(s) 233, 405
PsuI RGATCY 1 cut(s) 454
RsaI GTAC 2 cut(s) 97, 264
RsaNI GTAC 2 cut(s) 96, 263
SaqAI TTAA 4 cut(s) 161, 285, 330, 470
Sau3AI GATC 4 cut(s) 3, 102, 192, 454
Sau96I GGNCC 2 cut(s) 233, 405
SetI ASST 2 cut(s) 36, 42
SfaNI GCATC 2 cut(s) 37, 307
SfcI CTRYAG 1 cut(s) 15
SinI GGWCC 1 cut(s) 405
SmlI CTYRAG 4 cut(s) 206, 274, 337, 428
SmoI CTYRAG 4 cut(s) 206, 274, 337, 428
Sse9I AATT 7 cut(s) 132, 158, 182, 217, 286, 362, 418
SspMI CTAG 1 cut(s) 35
TaaI ACNGT 5 cut(s) 58, 95, 240, 328, 480
TasI AATT 7 cut(s) 132, 158, 182, 217, 286, 362, 418
Tru1I TTAA 4 cut(s) 161, 285, 330, 470
Tru9I TTAA 4 cut(s) 161, 285, 330, 470
TscAI CASTG 1 cut(s) 495
TseFI GTSAC 2 cut(s) 114, 413
Tsp45I GTSAC 2 cut(s) 114, 413
TspDTI ATGAA 2 cut(s) 230, 379
TspRI CASTG 1 cut(s) 495
VpaK11BI GGWCC 1 cut(s) 405
XapI RAATTY 2 cut(s) 182, 362
XmnI GAANNNNTTC 1 cut(s) 150
XspI CTAG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.