Rmu_sc0002532.1_g000017

Permuted single zf-CXXC unit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002532.1
Physical Location & Seq
Forward (+)
92903 .. 101761
8859 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002532.1_g000017.1.cds

Sequence Viewer

Length: 5166 bp
atggatatgaatgatcagagaaaagatgccttccaagactggccttcttgcattgctccaacaactccttacaggcctattctcccaaaaccacctcaagaacataaacaccatgaattttttatgcccccaaataaattcccgtttgctttaccagccaatgaagggaataatggagctggacctgttggtgccggcaacacactcgagatgtcgagagaggttccttgtatagatctcctggcccttgcccatgccgcctctagcgcagctgataataatgctgtcatgcatggagaacctcagtatgatgttccctttcctcaccaccttccttatgatctaaattcactacccgagaccacctatggccaatttgcacccataacaccagagaaggcaagctcaaatgcggatcataaaaaagaccagcaaattgaagagcagatgaatgctggtgctaccacatttgaaatctttgagctgggaaataagaaagatgtagcagaccctgctacagattcttcacatgctactttttccacacaagtccaggagaatcagacacagctccaggataatcacatcatcaaggaagggaatgatagcattgacttgaataagacaccgcagctgaaacaaaggaggagaaagcacaggcccaaggttattagagaaggcaagccaaaaccactgccgaaacctcctactactaaggaaactccagccagaagaaagtatgtaaggaagaatgcactagacaaaaatgcaactcctcccccaccaaaggaacttggggagtgtaccgattcaaataatctgaagtccaccaagagatcatgcagaagggtgttaaattatgacatggaagaaccaggagatgatatatcctcctgcagatctttcaattcaggtttggactcacagatgcgtaatttttgcaccaatggagttgcatcaaaatcaactgtgcagctcagaaatggaattaattcaatggtagataacactcggatggagttagcccatgaacttgttctttctacaaatcaatggctgaaagaacacttgtcactgcctgaacaacaatctccagccacaccgtgtcctgccagaaatagttccgtgcagccaagagagtatgttgattgccaacaagacactgcagaaggaaaagcaagagtgagtgctcaactctgtcacaaaaatgctgtacaaaccatgttggatggtgacactagatcctcttcaccaaggccaaatgactccaactgcagctcatccatgattctgacacaagaaaatgaactgaagggatccaagcgaaaatattataatgctgttcagcagacagatccaagtacccgaaatttacttggggttcactacaataatttgccagcatatgacaacatgatgtcttatatgcattttccatacatatacaagaagaagaggactgataaggcatatacttctatcatatcaagcacatcatgtcgtgtgactatggcagaaaatgtttggagacaatcaaaactgcaagctgttgagtctatcctgccttcttaccagacgcagagttcaaaaaagagaagatcaaaagctcctacacgggttcgtgacttggcttctctaattagaacaccagagcacattctgcgccagagtacctgtctcaccaaaccaccagctgatggtaatgggcaaagacgtatgaactgtaactcatctcagacatgcatggatgccctagtcactgacgtgggtgccacactcgcaaagaaaaagagaacaaagagaagttctgttaccagttcacaccgaagtattgtgctatacaagaaccaaccatttgttcccggatcatcaggtgttccaccagaagtagcatgcacacaaattctttccgttgatgctattactgatcaattaaaatgtttgaacttaaatagagagaacagcaaatttgcatatcaggggtataatgttgtctataatacacaaaagcaagagaacaatgctttggttctttatagaagagatggcactgttgtaccatttgagggggcttttgatcctatcaagaaacgtcggccacgacctaaagttgaccttgatgaagagacggataaagtatggaagctgctgatggataacataaacagtgaaggcgttgatggaacagatgaacagaaagcaaaatggtgggaagaagagcggagagtgttccaaggtcgcgcagactcttttatcgcacgaatgcatcttgtgcaaggagatagacgcttctctccatggaaaggatcagttgtggactcagtggtgggagttttcctgactcaaaatgtgtcagatcatctgtctagctctgcattcatgtcgctcgcagcacgttttcccctgaagtcagtgagcaaccaaaatgcatctgatgaaaaagttgcaggcttagcagtagatgaaccagaagtgtgcattagtgagatttcaaaccagccactctgtgattctagttccgtaacattccatgacactgagcatagtgaagaaaaagttgtcaacagcaatgagaacacagaaaccactagtgagggagttatctctacaaatgaacctgactgcaagctttcacattcattggccaacaggtccaccaccataaacccaagaacagcatcagaatgttgcatagaggaagacttgagaacaggatatgatatagtttcatctcaaaattctgtggattcttcaacttctcacactgtggaaaaagcaggatcatgtgagagcaactcagagacagaggacacgcctaatacatgtcaaaacggcagtttggaccattccacttcgtttttacagaaggccgcagtctacagtctcaaaaccagccatatgtcttctcatgacaatttgaattgtgaactttatgaacccatatgcatggagcatgatgaccaaagaagatatatagacaggggaggagcatcccaggacccttccaataatttttgtttgcatattacctccaacccagaagtagtgcaagttgagtgctctgatttgttcgaagaggtaatccaatcttctaatatttccaagaacaaatatgaagacagtctgggggaacagagtgtgctaacagcagaatctgcgagtcaagatacaataagtaataagcttactgtgaatgatcaagatgcacagagatgtttcaatgaatcatgcaattgcattgagggaaaaaataacttggttcagtctcaattcagggtgggtgggaacccgaataaggttgatgtacctgctgaggagcataaaaataagattcagcaaaattgcaacatttctcgtgagaccacagatattatgcataagggaccagagtcagatttaagcttcaacgaggtcagtaaggtggatgctgctacctcaaagacaaagaacagaagacctggaaaagagaaaaagcagcaggactgggacaaattaagagaacgagcagaaccaaatggaagaaaaagggagaaaacagcaaatacaatggattcagtggactgggaagctgtaagaactgcaaatgtaaatgacattgcccaaactatcaaagagagggggatgaataatatgctcgcggaaagaatcaaggaattccttaaccgactggttagagaacacgggagcgttgatcttgaatggttaagagatgttccacctgaccaagcaaaagagtatctgctgagcttccgaggactgggtctaaaaagcgtggagtgtgtgaggcttttgacacttcatcatcttgcttttccggtcgatacaaatgttggacgtattgctgtacggctgggatgggtaccccttcagcccttgcccgagtcactgcagttgcatcttctagaactgtacccagtgctggaatccatacaaaagtacttgtggccaagactttgcaagcttgaccaaagaaccttgtatgagctgcactaccagatgataacatttggaaaggtcttctgcacgaaaagcaaaccgaattgcaatgcatgtccaatgagaggagaatgtaggcattttgcaagtgcatttgcaagtgcaagacttgccttgccggggcccgaggagaaaagtatagtgagtgcaactgaagacagaaatacctatcaaaaccctggtgagatcaacaatggaatgcctttgcctctccctctccctcatcctcatcctcatcctcaccgaacagaacagttggaaggaaaccagcaacttgcagcaagccaactatcagaaccaaagtctacactaggttattgtgaaccaattattgaagaaccagctacaccagagccagagtgcacacagatagtagaggacattgaggacttctatgaggacccagatgaaattcctacaattaaacttaacatggaacagttcactcagaacttgcaaaattatatgcaacaaaacatggaacttcaagaaggagaaatgtcaaaggctttagttgctctaacaccagatgctgcatctcttcctacaccgaagcttaagaatgtgagccgactacgaactgagcaccaagtctatgaacttcctgattcacaccctcttctagatcggttggggttggataagcgagaacctgatgatccatgcaattaccttttggccatttggacaccaggtgaaacagcaaactccattcaaccaccagagaataggtgtagttctcaagaatttggcaaattgtgtgatgataaggaatgtttccaatgcaatagtgcacgggaagcatattcacaaacagttcgagggactctcttgataccatgccgaacagcaatgagagggagcttcccacttaacggcacctactttcaagttaatgaggtgtttgctgatcatgattcaagccttgagcctcttgatgttccaagaggctggttgtggaatctgaataggagaactgtgtactttggaacctcaataccaacaatattcaaagggttaacaacaccagaaattcaacattgcttttggagaggatttgtgtgtgtgagggggtttgatcagaaatcaaggggtccgcgtcctttaatggctcgattgcacttcccagccagcaggttggctaaaccaaaagacaagaaagaggagtag
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1721

Amino Acids

193.66

Weight (kDa)

6.14

Isoelectric Point (pI)

53.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1335
Acc36I ACCTGC 2 cut(s) 3316, 5121
Acc65I GGTACC 1 cut(s) 3859
AccB1I GGYRCC 4 cut(s) 191, 1769, 3859, 4874
AccB7I CCANNNNNTGG 1 cut(s) 1697
AccBSI CCGCTC 1 cut(s) 2221
AccI GTMKAC 2 cut(s) 2877, 4301
AccII CGCG 3 cut(s) 2241, 3638, 5095
AciI CCGC 7 cut(s) 258, 413, 629, 2221, 2871, 3638, 5093
AcoI YGGCCR 5 cut(s) 370, 2096, 2643, 3944, 4674
AcuI CTGAAG 5 cut(s) 842, 1331, 2426, 3851, 4170
AdeI CACNNNGTG 4 cut(s) 1104, 2507, 2767, 4691
AflII CTTAAG 1 cut(s) 4553
AflIII ACRYGT 1 cut(s) 2822
AhlI ACTAGT 1 cut(s) 2588
AjiI CACGTC 1 cut(s) 1765
AjnI CCWGG 8 cut(s) 240, 552, 573, 874, 2994, 3457, 4174, 4687
AjuI GAANNNNNNNTTGG 4 cut(s) 1842, 1874, 2009, 2041
AleI CACNNNNGTG 1 cut(s) 1763
Alw21I GWGCWC 6 cut(s) 1192, 1656, 3062, 4361, 4584, 4792
Alw26I GTCTC 8 cut(s) 353, 1522, 1682, 2120, 2795, 2888, 3270, 3353
Alw44I GTGCAC 2 cut(s) 4357, 4788
AlwNI CAGNNNCTG 3 cut(s) 512, 3155, 4529
Ama87I CYCGRG 4 cut(s) 206, 356, 3878, 4121
ApaI GGGCCC 1 cut(s) 4122
ApaLI GTGCAC 2 cut(s) 4357, 4788
AseI ATTAAT 1 cut(s) 990
Asp700I GAANNNNTTC 3 cut(s) 991, 1035, 1120
Asp718I GGTACC 1 cut(s) 3859
AspLEI GCGC 3 cut(s) 269, 1665, 2243
AsuC2I CCSGG 2 cut(s) 1863, 4116
AsuHPI GGTGA 7 cut(s) 317, 1242, 1244, 1672, 4190, 4229, 4703
AsuII TTCGAA 1 cut(s) 3072
AvaI CYCGRG 4 cut(s) 206, 356, 3878, 4121
AvaII GGWCC 7 cut(s) 182, 2652, 2842, 2998, 3383, 4396, 5090
BaeGI GKGCMC 3 cut(s) 4122, 4361, 4792
BaeI ACNNNNGTAYC 4 cut(s) 2040, 2073, 3813, 3846
BalI TGGCCA 4 cut(s) 372, 2645, 3946, 4676
BamHI GGATCC 1 cut(s) 1316
BanI GGYRCC 4 cut(s) 191, 1769, 3859, 4874
BanII GRGCYC 1 cut(s) 4122
BarI GAAGNNNNNNTAC 2 cut(s) 1795, 1827
BauI CACGAG 1 cut(s) 3354
BbsI GAAGAC 6 cut(s) 2706, 2895, 3123, 3460, 4009, 4158
Bbv12I GWGCWC 6 cut(s) 1192, 1656, 3062, 4361, 4584, 4792
BbvCI CCTCAGC 1 cut(s) 3312
BccI CCATC 7 cut(s) 1009, 1223, 1691, 2039, 2146, 2174, 3849
BceAI ACGGC 3 cut(s) 2848, 3863, 4888
BcgI CGANNNNNNTGC 4 cut(s) 187, 221, 2364, 2398
BciT130I CCWGG 8 cut(s) 242, 554, 575, 876, 2996, 3459, 4176, 4689
BclI TGATCA 5 cut(s) 13, 1927, 3196, 4906, 5074
BcnI CCSGG 2 cut(s) 1863, 4116
BcoDI GTCTC 8 cut(s) 353, 1522, 1682, 2120, 2795, 2888, 3270, 3353
BcuI ACTAGT 1 cut(s) 2588
BfmI CTRYAG 6 cut(s) 516, 895, 1164, 1273, 2878, 3887
BfrI CTTAAG 1 cut(s) 4553
BfuAI ACCTGC 2 cut(s) 3316, 5121
BglII AGATCT 2 cut(s) 235, 899
BlpI GCTNAGC 2 cut(s) 2452, 3743
BmcAI AGTACT 1 cut(s) 3938
Bme18I GGWCC 7 cut(s) 182, 2652, 2842, 2998, 3383, 4396, 5090
BmeT110I CYCGRG 4 cut(s) 206, 356, 3878, 4121
BmgBI CACGTC 1 cut(s) 1765
BmrI ACTGGG 4 cut(s) 3493, 3571, 3767, 3908
BmuI ACTGGG 4 cut(s) 3493, 3571, 3767, 3908
BoxI GACNNNNGTC 1 cut(s) 3388
BpiI GAAGAC 6 cut(s) 2706, 2895, 3123, 3460, 4009, 4158
BplI GAGNNNNNCTC 4 cut(s) 2780, 2812, 4809, 4841
BpmI CTGGAG 3 cut(s) 557, 708, 1077
Bpu10I CCTNAGC 1 cut(s) 3312
Bpu1102I GCTNAGC 2 cut(s) 2452, 3743
Bpu14I TTCGAA 1 cut(s) 3072
BpuEI CTTGAG 4 cut(s) 81, 2725, 4722, 4943
BpuMI CCSGG 2 cut(s) 1863, 4116
BsaI GGTCTC 2 cut(s) 353, 3353
BsaJI CCNNGG 9 cut(s) 663, 1253, 2233, 2297, 2994, 3751, 4115, 4122, 4174
BsaWI WCCGGW 1 cut(s) 3814
Bse118I RCCGGY 1 cut(s) 194
Bse1I ACTGG 7 cut(s) 44, 1815, 3488, 3566, 3672, 3762, 3914
Bse3DI GCAATG 6 cut(s) 51, 2575, 3594, 4051, 4854, 5035
BseBI CCWGG 8 cut(s) 242, 554, 575, 876, 2996, 3459, 4176, 4689
BseDI CCNNGG 9 cut(s) 663, 1253, 2233, 2297, 2994, 3751, 4115, 4122, 4174
BseMI GCAATG 6 cut(s) 51, 2575, 3594, 4051, 4854, 5035
BseNI ACTGG 7 cut(s) 44, 1815, 3488, 3566, 3672, 3762, 3914
BseRI GAGGAG 6 cut(s) 661, 765, 3000, 3329, 4077, 4139
BseSI GKGCMC 3 cut(s) 4122, 4361, 4792
BseYI CCCAGC 3 cut(s) 484, 3850, 5122
BsgI GTGCAG 4 cut(s) 992, 1148, 3971, 4006
Bsh1236I CGCG 3 cut(s) 2241, 3638, 5095
Bsh1285I CGRYCG 1 cut(s) 3819
BshNI GGYRCC 4 cut(s) 191, 1769, 3859, 4874
BsiEI CGRYCG 1 cut(s) 3819
BsiHKAI GWGCWC 6 cut(s) 1192, 1656, 3062, 4361, 4584, 4792
BsiHKCI CYCGRG 4 cut(s) 206, 356, 3878, 4121
BsiSI CCGG 4 cut(s) 195, 1863, 3815, 4115
BslFI GGGAC 3 cut(s) 3396, 3500, 4834
BsmAI GTCTC 8 cut(s) 353, 1522, 1682, 2120, 2795, 2888, 3270, 3353
BsmBI CGTCTC 1 cut(s) 2120
BsmFI GGGAC 3 cut(s) 3396, 3500, 4834
BsmI GAATGC 5 cut(s) 457, 757, 2268, 2375, 4200
Bso31I GGTCTC 2 cut(s) 353, 3353
BsoBI CYCGRG 4 cut(s) 206, 356, 3878, 4121
Bsp119I TTCGAA 1 cut(s) 3072
Bsp120I GGGCCC 1 cut(s) 4118
Bsp1286I GDGCHC 7 cut(s) 1192, 1656, 3062, 4122, 4361, 4584, 4792
Bsp1407I TGTACA 1 cut(s) 1213
Bsp1720I GCTNAGC 2 cut(s) 2452, 3743
Bsp19I CCATGG 1 cut(s) 2297
BspACI CCGC 7 cut(s) 258, 413, 629, 2221, 2871, 3638, 5093
BspFNI CGCG 3 cut(s) 2241, 3638, 5095
BspHI TCATGA 2 cut(s) 2908, 4909
BspMAI CTGCAG 4 cut(s) 899, 1168, 1277, 3891
BspMI ACCTGC 2 cut(s) 3316, 5121
BspQI GCTCTTC 2 cut(s) 435, 2211
BspT104I TTCGAA 1 cut(s) 3072
BspT107I GGYRCC 4 cut(s) 191, 1769, 3859, 4874
BspTI CTTAAG 1 cut(s) 4553
BspTNI GGTCTC 2 cut(s) 353, 3353
BsrBI CCGCTC 1 cut(s) 2221
BsrDI GCAATG 6 cut(s) 51, 2575, 3594, 4051, 4854, 5035
BsrFI RCCGGY 1 cut(s) 194
BsrGI TGTACA 1 cut(s) 1213
BsrI ACTGG 7 cut(s) 44, 1815, 3488, 3566, 3672, 3762, 3914
BssAI RCCGGY 1 cut(s) 194
BssECI CCNNGG 9 cut(s) 663, 1253, 2233, 2297, 2994, 3751, 4115, 4122, 4174
BssSI CACGAG 1 cut(s) 3354
BssT1I CCWWGG 4 cut(s) 663, 1253, 2233, 2297
Bst2BI CACGAG 1 cut(s) 3354
Bst2UI CCWGG 8 cut(s) 242, 554, 575, 876, 2996, 3459, 4176, 4689
Bst6I CTCTTC 9 cut(s) 435, 1252, 1448, 2035, 2118, 2211, 3069, 4542, 4620
BstAFI CTTAAG 1 cut(s) 4553
BstAPI GCANNNNNTGC 5 cut(s) 512, 1660, 2272, 3155, 4106
BstAUI TGTACA 1 cut(s) 1213
BstBI TTCGAA 1 cut(s) 3072
BstDSI CCRYGG 1 cut(s) 2297
BstFNI CGCG 3 cut(s) 2241, 3638, 5095
BstHHI GCGC 3 cut(s) 269, 1665, 2243
BstMAI GTCTC 8 cut(s) 353, 1522, 1682, 2120, 2795, 2888, 3270, 3353
BstMCI CGRYCG 1 cut(s) 3819
BstNI CCWGG 8 cut(s) 242, 554, 575, 876, 2996, 3459, 4176, 4689
BstNSI RCATGY 5 cut(s) 533, 1743, 1896, 2826, 4053
BstPAI GACNNNNGTC 1 cut(s) 3388
BstSFI CTRYAG 6 cut(s) 516, 895, 1164, 1273, 2878, 3887
BstSLI GKGCMC 3 cut(s) 4122, 4361, 4792
BstUI CGCG 3 cut(s) 2241, 3638, 5095
BstV2I GAAGAC 6 cut(s) 2706, 2895, 3123, 3460, 4009, 4158
BstX2I RGATCY 5 cut(s) 235, 899, 1241, 1316, 1354
BstXI CCANNNNNNTGG 3 cut(s) 2947, 4947, 5134
BstYI RGATCY 5 cut(s) 235, 899, 1241, 1316, 1354
BtgI CCRYGG 1 cut(s) 2297
BtrI CACGTC 1 cut(s) 1765
BtsI GCAGTG 4 cut(s) 692, 1073, 1161, 3884
BveI ACCTGC 2 cut(s) 3316, 5121
CaiI CAGNNNCTG 3 cut(s) 512, 3155, 4529
CciI TCATGA 2 cut(s) 2908, 4909
CfoI GCGC 3 cut(s) 269, 1665, 2243
Cfr10I RCCGGY 1 cut(s) 194
CseI GACGC 3 cut(s) 1585, 2295, 5084
CsiI ACCWGGT 1 cut(s) 4687
DraIII CACNNNGTG 4 cut(s) 1104, 2507, 2767, 4691
EaeI YGGCCR 5 cut(s) 370, 2096, 2643, 3944, 4674
Eam1104I CTCTTC 9 cut(s) 435, 1252, 1448, 2035, 2118, 2211, 3069, 4542, 4620
EarI CTCTTC 9 cut(s) 435, 1252, 1448, 2035, 2118, 2211, 3069, 4542, 4620
Eco130I CCWWGG 4 cut(s) 663, 1253, 2233, 2297
Eco147I AGGCCT 1 cut(s) 76
Eco24I GRGCYC 1 cut(s) 4122
Eco31I GGTCTC 2 cut(s) 353, 3353
Eco47I GGWCC 7 cut(s) 182, 2652, 2842, 2998, 3383, 4396, 5090
Eco57I CTGAAG 5 cut(s) 842, 1331, 2426, 3851, 4170
Eco88I CYCGRG 4 cut(s) 206, 356, 3878, 4121
EcoO109I RGGNCCY 3 cut(s) 2998, 4118, 4396
EcoRI GAATTC 1 cut(s) 3653
EcoRII CCWGG 8 cut(s) 240, 552, 573, 874, 2994, 3457, 4174, 4687
EcoT14I CCWWGG 4 cut(s) 663, 1253, 2233, 2297
EcoT22I ATGCAT 8 cut(s) 294, 1431, 1745, 2268, 2431, 2948, 3378, 4051
EcoT38I GRGCYC 1 cut(s) 4122
ErhI CCWWGG 4 cut(s) 663, 1253, 2233, 2297
Esp3I CGTCTC 1 cut(s) 2120
FalI AAGNNNNNCTT 2 cut(s) 2100, 2132
FaqI GGGAC 3 cut(s) 3396, 3500, 4834
FauNDI CATATG 3 cut(s) 1405, 2898, 2942
FbaI TGATCA 5 cut(s) 13, 1927, 3196, 4906, 5074
FblI GTMKAC 2 cut(s) 2877, 4301
FriOI GRGCYC 1 cut(s) 4122
GlaI GCGC 3 cut(s) 268, 1664, 2242
GsaI CCCAGC 3 cut(s) 488, 3854, 5126
GsuI CTGGAG 3 cut(s) 557, 708, 1077
HapII CCGG 4 cut(s) 195, 1863, 3815, 4115
HgaI GACGC 3 cut(s) 1585, 2295, 5084
HhaI GCGC 3 cut(s) 269, 1665, 2243
Hin6I GCGC 3 cut(s) 267, 1663, 2241
HinP1I GCGC 3 cut(s) 267, 1663, 2241
HincII GTYRAC 3 cut(s) 2113, 2563, 5016
HindII GTYRAC 3 cut(s) 2113, 2563, 5016
HindIII AAGCTT 5 cut(s) 2627, 3182, 3400, 3959, 4550
HpaI GTTAAC 1 cut(s) 5016
HpaII CCGG 4 cut(s) 195, 1863, 3815, 4115
HphI GGTGA 7 cut(s) 317, 1242, 1244, 1672, 4190, 4229, 4703
Hpy99I CGWCG 1 cut(s) 2097
HpyCH4IV ACGT 5 cut(s) 1714, 1764, 2092, 2395, 3835
HpySE526I ACGT 5 cut(s) 1714, 1764, 2092, 2395, 3835
HspAI GCGC 3 cut(s) 267, 1663, 2241
KpnI GGTACC 1 cut(s) 3863
KroI GCCGGC 1 cut(s) 194
KroNI GCCGGC 1 cut(s) 196
Ksp22I TGATCA 5 cut(s) 13, 1927, 3196, 4906, 5074
KspAI GTTAAC 1 cut(s) 5016
LguI GCTCTTC 2 cut(s) 435, 2211
LmnI GCTCC 9 cut(s) 61, 176, 576, 1612, 2950, 2987, 3316, 3684, 4857
MabI ACCWGGT 1 cut(s) 4687
MaeII ACGT 5 cut(s) 1714, 1764, 2092, 2395, 3835
MbiI CCGCTC 1 cut(s) 2221
MfeI CAATTG 1 cut(s) 3232
MflI RGATCY 5 cut(s) 235, 899, 1241, 1316, 1354
MhlI GDGCHC 7 cut(s) 1192, 1656, 3062, 4122, 4361, 4584, 4792
MlsI TGGCCA 4 cut(s) 372, 2645, 3946, 4676
MluNI TGGCCA 4 cut(s) 372, 2645, 3946, 4676
MmeI TCCRAC 7 cut(s) 83, 1206, 1293, 3057, 3811, 4233, 4614
Mox20I TGGCCA 4 cut(s) 372, 2645, 3946, 4676
Mph1103I ATGCAT 8 cut(s) 294, 1431, 1745, 2268, 2431, 2948, 3378, 4051
MroNI GCCGGC 1 cut(s) 194
MroXI GAANNNNTTC 3 cut(s) 991, 1035, 1120
MscI TGGCCA 4 cut(s) 372, 2645, 3946, 4676
MslI CAYNNNNRTG 6 cut(s) 1013, 1206, 1763, 2683, 2945, 3211
Msp20I TGGCCA 4 cut(s) 372, 2645, 3946, 4676
MspA1I CMGCKG 3 cut(s) 272, 634, 1694
MspCI CTTAAG 1 cut(s) 4553
MspI CCGG 4 cut(s) 195, 1863, 3815, 4115
MunI CAATTG 1 cut(s) 3232
Mva1269I GAATGC 5 cut(s) 457, 757, 2268, 2375, 4200
MvaI CCWGG 8 cut(s) 242, 554, 575, 876, 2996, 3459, 4176, 4689
MvnI CGCG 3 cut(s) 2241, 3638, 5095
NaeI GCCGGC 1 cut(s) 196
NciI CCSGG 2 cut(s) 1863, 4116
NcoI CCATGG 1 cut(s) 2297
NdeI CATATG 3 cut(s) 1405, 2898, 2942
NgoMIV GCCGGC 1 cut(s) 194
NmuCI GTSAC 7 cut(s) 1071, 1199, 1232, 1504, 1622, 1756, 3882
NsiI ATGCAT 8 cut(s) 294, 1431, 1745, 2268, 2431, 2948, 3378, 4051
NspI RCATGY 5 cut(s) 533, 1743, 1896, 2826, 4053
NspV TTCGAA 1 cut(s) 3072
OliI CACNNNNGTG 1 cut(s) 1763
PaeI GCATGC 1 cut(s) 1896
PaeR7I CTCGAG 1 cut(s) 206
PagI TCATGA 2 cut(s) 2908, 4909
PceI AGGCCT 1 cut(s) 76
PciI ACATGT 1 cut(s) 2822
PciSI GCTCTTC 2 cut(s) 435, 2211
PcsI WCGNNNNNNNCGW 1 cut(s) 2098
PctI GAATGC 5 cut(s) 457, 757, 2268, 2375, 4200
PdiI GCCGGC 1 cut(s) 196
PdmI GAANNNNTTC 3 cut(s) 991, 1035, 1120
PflFI GACNNNGTC 1 cut(s) 3759
PflMI CCANNNNNTGG 1 cut(s) 1697
PfoI TCCNGGA 3 cut(s) 552, 573, 1861
PpuMI RGGWCCY 2 cut(s) 2998, 4396
PscI ACATGT 1 cut(s) 2822
PshAI GACNNNNGTC 1 cut(s) 3388
PshBI ATTAAT 1 cut(s) 990
PsiI TTATAA 1 cut(s) 1335
Psp5II RGGWCCY 2 cut(s) 2998, 4396
Psp6I CCWGG 8 cut(s) 240, 552, 573, 874, 2994, 3457, 4174, 4687
PspFI CCCAGC 3 cut(s) 484, 3850, 5122
PspGI CCWGG 8 cut(s) 240, 552, 573, 874, 2994, 3457, 4174, 4687
PspOMI GGGCCC 1 cut(s) 4118
PspPPI RGGWCCY 2 cut(s) 2998, 4396
PstI CTGCAG 4 cut(s) 899, 1168, 1277, 3891
PstNI CAGNNNCTG 3 cut(s) 512, 3155, 4529
PsuI RGATCY 5 cut(s) 235, 899, 1241, 1316, 1354
PsyI GACNNNGTC 1 cut(s) 3759
PvuII CAGCTG 3 cut(s) 272, 634, 1694
RseI CAYNNNNRTG 6 cut(s) 1013, 1206, 1763, 2683, 2945, 3211
SapI GCTCTTC 2 cut(s) 435, 2211
ScaI AGTACT 1 cut(s) 3938
SduI GDGCHC 7 cut(s) 1192, 1656, 3062, 4122, 4361, 4584, 4792
SexAI ACCWGGT 1 cut(s) 4687
SfcI CTRYAG 6 cut(s) 516, 895, 1164, 1273, 2878, 3887
Sfr274I CTCGAG 1 cut(s) 206
SfuI TTCGAA 1 cut(s) 3072
SinI GGWCC 7 cut(s) 182, 2652, 2842, 2998, 3383, 4396, 5090
SlaI CTCGAG 1 cut(s) 206
SmiMI CAYNNNNRTG 6 cut(s) 1013, 1206, 1763, 2683, 2945, 3211
SmlI CTYRAG 6 cut(s) 96, 206, 2704, 4553, 4737, 4922
SmoI CTYRAG 6 cut(s) 96, 206, 2704, 4553, 4737, 4922
SpeI ACTAGT 1 cut(s) 2588
SphI GCATGC 1 cut(s) 1896
SseBI AGGCCT 1 cut(s) 76
SsiI CCGC 7 cut(s) 258, 413, 629, 2221, 2871, 3638, 5093
SspI AATATT 3 cut(s) 1331, 3097, 5004
StuI AGGCCT 1 cut(s) 76
StyI CCWWGG 4 cut(s) 663, 1253, 2233, 2297
TaiI ACGT 5 cut(s) 1717, 1767, 2095, 2398, 3838
TaqI TCGA 6 cut(s) 207, 215, 3072, 3819, 4816, 5110
TatI WGTACW 3 cut(s) 1213, 3936, 4977
TauI GCSGC 2 cut(s) 260, 2873
TseFI GTSAC 7 cut(s) 1071, 1199, 1232, 1504, 1622, 1756, 3882
Tsp45I GTSAC 7 cut(s) 1071, 1199, 1232, 1504, 1622, 1756, 3882
TspGWI ACGGA 4 cut(s) 1114, 1900, 2144, 2509
Tth111I GACNNNGTC 1 cut(s) 3759
Van91I CCANNNNNTGG 1 cut(s) 1697
Vha464I CTTAAG 1 cut(s) 4553
VneI GTGCAC 2 cut(s) 4357, 4788
VpaK11BI GGWCC 7 cut(s) 182, 2652, 2842, 2998, 3383, 4396, 5090
VspI ATTAAT 1 cut(s) 990
XbaI TCTAGA 2 cut(s) 3901, 4618
XceI RCATGY 5 cut(s) 533, 1743, 1896, 2826, 4053
XhoI CTCGAG 1 cut(s) 206
XmiI GTMKAC 2 cut(s) 2877, 4301
XmnI GAANNNNTTC 3 cut(s) 991, 1035, 1120
ZrmI AGTACT 1 cut(s) 3938
Zsp2I ATGCAT 8 cut(s) 294, 1431, 1745, 2268, 2431, 2948, 3378, 4051
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.