Rmu_sc0002575.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002575.1
OG0006412
Physical Location & Seq
Forward (+)
8299 .. 9496
1198 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002575.1_g000001.1.cds

Sequence Viewer

Length: 627 bp
atggcttttttagctacggttcttgtactactacctatggctacttttgctgtggactggccagatatatctcctactgctgcaaaggaaatatgtaaagaagtggagtgtggaagaggaacatgcaattataactccagtgcgccattactctatacgtgtgagtgtgaaactggatggaagcgaaccgccgaaggaaatgatactctcaagtttctcccttgtgtcatccctgactgtaccctggactacaccaattgccaagcaccacctaaagttccagattacacacaacttccaagcaattcatctgcatttgacccttgcaactgggtttactgcggagaaggtacatgcgtgaagaactcaacctatgtgtacacaccggagtgtaaatgcaactcaggggcgtcgaatcttctcaacgtcacagtattcccatgctacagtgaatgcacacttaaacccgactgtgaacgccttggaatcacagttgcaaattcgactaccaattcaactacctcttctgacgggaatgacagtaataaagctaccgagtttatgccaggaaaattccagttggtgactatagtgatggtctctgtgggtatgatcctgtggaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

208

Amino Acids

22.64

Weight (kDa)

4.58

Isoelectric Point (pI)

30.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 132
AciI CCGC 2 cut(s) 189, 342
AclWI GGATC 1 cut(s) 607
AcoI YGGCCR 1 cut(s) 59
AcsI RAATTY 2 cut(s) 499, 572
AcyI GRCGYC 1 cut(s) 410
AfaI GTAC 4 cut(s) 27, 241, 352, 380
AflIII ACRYGT 1 cut(s) 158
AgsI TTSAA 1 cut(s) 516
AjnI CCWGG 2 cut(s) 243, 565
AleI CACNNNNGTG 1 cut(s) 388
AluBI AGCT 2 cut(s) 14, 551
AluI AGCT 2 cut(s) 14, 551
Alw26I GTCTC 1 cut(s) 604
AlwI GGATC 1 cut(s) 607
AoxI GGCC 1 cut(s) 59
ApeKI GCWGC 1 cut(s) 80
ApoI RAATTY 2 cut(s) 499, 572
AspLEI GCGC 1 cut(s) 145
AsuHPI GGTGA 1 cut(s) 595
BaeI ACNNNNGTAYC 2 cut(s) 342, 375
BalI TGGCCA 1 cut(s) 61
BbvI GCAGC 1 cut(s) 67
BccI CCATC 2 cut(s) 171, 589
BciT130I CCWGG 2 cut(s) 245, 567
BcoDI GTCTC 1 cut(s) 604
BfmI CTRYAG 2 cut(s) 445, 588
BisI GCNGC 1 cut(s) 81
BlsI GCNGC 1 cut(s) 82
Bme1390I CCNGG 2 cut(s) 245, 567
BmrFI CCNGG 2 cut(s) 245, 567
BmrI ACTGGG 1 cut(s) 340
BmuI ACTGGG 1 cut(s) 340
BpmI CTGGAG 1 cut(s) 121
BpuEI CTTGAG 1 cut(s) 194
BsaAI YACGTR 1 cut(s) 159
BsaHI GRCGYC 1 cut(s) 410
BsaI GGTCTC 1 cut(s) 604
BsaJI CCNNGG 2 cut(s) 243, 481
BsaWI WCCGGW 1 cut(s) 385
Bse1I ACTGG 5 cut(s) 62, 138, 178, 335, 577
BseBI CCWGG 2 cut(s) 245, 567
BseDI CCNNGG 2 cut(s) 243, 481
BseGI GGATG 2 cut(s) 182, 228
BseMII CTCAG 1 cut(s) 417
BseNI ACTGG 5 cut(s) 62, 138, 178, 335, 577
BseXI GCAGC 1 cut(s) 67
BshFI GGCC 1 cut(s) 61
BsiSI CCGG 1 cut(s) 386
BsmAI GTCTC 1 cut(s) 604
BsmI GAATGC 1 cut(s) 458
BsnI GGCC 1 cut(s) 61
Bso31I GGTCTC 1 cut(s) 604
Bsp1407I TGTACA 1 cut(s) 378
Bsp143I GATC 1 cut(s) 612
BspACI CCGC 2 cut(s) 189, 342
BspANI GGCC 1 cut(s) 61
BspCNI CTCAG 1 cut(s) 416
BspPI GGATC 1 cut(s) 607
BspTNI GGTCTC 1 cut(s) 604
BsrGI TGTACA 1 cut(s) 378
BsrI ACTGG 5 cut(s) 62, 138, 178, 335, 577
BssECI CCNNGG 2 cut(s) 243, 481
BssMI GATC 1 cut(s) 612
BssNI GRCGYC 1 cut(s) 410
BssT1I CCWWGG 1 cut(s) 481
Bst2UI CCWGG 2 cut(s) 245, 567
Bst4CI ACNGT 7 cut(s) 19, 239, 433, 449, 473, 493, 542
Bst6I CTCTTC 2 cut(s) 109, 529
BstACI GRCGYC 1 cut(s) 410
BstAUI TGTACA 1 cut(s) 378
BstBAI YACGTR 1 cut(s) 159
BstDEI CTNAG 1 cut(s) 403
BstF5I GGATG 2 cut(s) 182, 228
BstHHI GCGC 1 cut(s) 145
BstKTI GATC 1 cut(s) 615
BstMAI GTCTC 1 cut(s) 604
BstMBI GATC 1 cut(s) 612
BstMWI GCNNNNNNNGC 2 cut(s) 11, 47
BstNI CCWGG 2 cut(s) 245, 567
BstNSI RCATGY 2 cut(s) 126, 357
BstSCI CCNGG 2 cut(s) 243, 565
BstSFI CTRYAG 2 cut(s) 445, 588
BstV1I GCAGC 1 cut(s) 67
BsuRI GGCC 1 cut(s) 61
BtsCI GGATG 2 cut(s) 182, 228
BtsIMutI CAGTG 2 cut(s) 145, 454
CfoI GCGC 1 cut(s) 145
CseI GACGC 1 cut(s) 399
Csp6I GTAC 4 cut(s) 26, 240, 351, 379
CviAII CATG 3 cut(s) 123, 354, 441
CviJI RGCY 5 cut(s) 5, 14, 41, 61, 551
CviKI_1 RGCY 5 cut(s) 5, 14, 41, 61, 551
CviQI GTAC 4 cut(s) 26, 240, 351, 379
DdeI CTNAG 1 cut(s) 403
DpnI GATC 1 cut(s) 614
DpnII GATC 1 cut(s) 612
EaeI YGGCCR 1 cut(s) 59
Eam1104I CTCTTC 2 cut(s) 109, 529
EarI CTCTTC 2 cut(s) 109, 529
Eco130I CCWWGG 1 cut(s) 481
Eco31I GGTCTC 1 cut(s) 604
EcoRII CCWGG 2 cut(s) 243, 565
EcoT14I CCWWGG 1 cut(s) 481
ErhI CCWWGG 1 cut(s) 481
FaeI CATG 3 cut(s) 126, 357, 444
FatI CATG 3 cut(s) 122, 353, 440
Fnu4HI GCNGC 1 cut(s) 81
FokI GGATG 2 cut(s) 189, 215
Fsp4HI GCNGC 1 cut(s) 81
GlaI GCGC 1 cut(s) 144
GluI GCNGC 1 cut(s) 81
GsuI CTGGAG 1 cut(s) 121
HaeIII GGCC 1 cut(s) 61
HapII CCGG 1 cut(s) 386
HgaI GACGC 1 cut(s) 399
HhaI GCGC 1 cut(s) 145
Hin1I GRCGYC 1 cut(s) 410
Hin1II CATG 3 cut(s) 126, 357, 444
Hin6I GCGC 1 cut(s) 143
HinP1I GCGC 1 cut(s) 143
HinfI GANTC 2 cut(s) 415, 486
HpaII CCGG 1 cut(s) 386
HphI GGTGA 1 cut(s) 595
Hpy166II GTNNAC 5 cut(s) 55, 337, 379, 381, 476
Hpy188I TCNGA 1 cut(s) 529
Hpy188III TCNNGA 1 cut(s) 281
Hpy8I GTNNAC 5 cut(s) 55, 337, 379, 381, 476
Hpy99I CGWCG 1 cut(s) 415
HpyAV CCTTC 2 cut(s) 188, 341
HpyCH4III ACNGT 7 cut(s) 19, 239, 433, 449, 473, 493, 542
HpyCH4IV ACGT 2 cut(s) 158, 426
HpyCH4V TGCA 7 cut(s) 83, 126, 314, 327, 399, 456, 497
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 47
HpyF3I CTNAG 1 cut(s) 403
HpySE526I ACGT 2 cut(s) 158, 426
Hsp92I GRCGYC 1 cut(s) 410
Hsp92II CATG 3 cut(s) 126, 357, 444
HspAI GCGC 1 cut(s) 143
Kzo9I GATC 1 cut(s) 612
Lsp1109I GCAGC 1 cut(s) 67
MaeII ACGT 2 cut(s) 158, 426
MaeIII GTNAC 2 cut(s) 427, 583
MalI GATC 1 cut(s) 614
MboI GATC 1 cut(s) 612
MboII GAAGA 4 cut(s) 126, 373, 410, 516
MfeI CAATTG 1 cut(s) 256
MlsI TGGCCA 1 cut(s) 61
MluCI AATT 6 cut(s) 127, 256, 304, 499, 511, 572
MluNI TGGCCA 1 cut(s) 61
MnlI CCTC 2 cut(s) 110, 532
Mox20I TGGCCA 1 cut(s) 61
MscI TGGCCA 1 cut(s) 61
MseI TTAA 1 cut(s) 462
MslI CAYNNNNRTG 1 cut(s) 388
Msp20I TGGCCA 1 cut(s) 61
MspI CCGG 1 cut(s) 386
MspR9I CCNGG 2 cut(s) 245, 567
MunI CAATTG 1 cut(s) 256
Mva1269I GAATGC 1 cut(s) 458
MvaI CCWGG 2 cut(s) 245, 567
MwoI GCNNNNNNNGC 2 cut(s) 11, 47
NdeII GATC 1 cut(s) 612
NlaIII CATG 3 cut(s) 126, 357, 444
NmuCI GTSAC 2 cut(s) 427, 583
NspI RCATGY 2 cut(s) 126, 357
OliI CACNNNNGTG 1 cut(s) 388
PctI GAATGC 1 cut(s) 458
PfeI GAWTC 2 cut(s) 415, 486
PkrI GCNGC 1 cut(s) 82
Ppu21I YACGTR 1 cut(s) 159
PsiI TTATAA 1 cut(s) 132
Psp6I CCWGG 2 cut(s) 243, 565
PspGI CCWGG 2 cut(s) 243, 565
RsaI GTAC 4 cut(s) 27, 241, 352, 380
RsaNI GTAC 4 cut(s) 26, 240, 351, 379
RseI CAYNNNNRTG 1 cut(s) 388
SaqAI TTAA 1 cut(s) 462
SatI GCNGC 1 cut(s) 81
Sau3AI GATC 1 cut(s) 612
ScrFI CCNGG 2 cut(s) 245, 567
SetI ASST 9 cut(s) 16, 37, 161, 274, 352, 374, 429, 524, 553
SfcI CTRYAG 2 cut(s) 445, 588
SmiMI CAYNNNNRTG 1 cut(s) 388
SmlI CTYRAG 1 cut(s) 209
SmoI CTYRAG 1 cut(s) 209
Sse9I AATT 6 cut(s) 127, 256, 304, 499, 511, 572
SsiI CCGC 2 cut(s) 189, 342
StyD4I CCNGG 2 cut(s) 243, 565
StyI CCWWGG 1 cut(s) 481
TaaI ACNGT 7 cut(s) 19, 239, 433, 449, 473, 493, 542
TaiI ACGT 2 cut(s) 161, 429
TaqI TCGA 2 cut(s) 413, 503
TasI AATT 6 cut(s) 127, 256, 304, 499, 511, 572
TatI WGTACW 2 cut(s) 25, 378
TfiI GAWTC 2 cut(s) 415, 486
Tru1I TTAA 1 cut(s) 462
Tru9I TTAA 1 cut(s) 462
TscAI CASTG 2 cut(s) 145, 454
TseFI GTSAC 2 cut(s) 427, 583
TseI GCWGC 1 cut(s) 80
Tsp45I GTSAC 2 cut(s) 427, 583
TspDTI ATGAA 1 cut(s) 297
TspRI CASTG 2 cut(s) 145, 454
XapI RAATTY 2 cut(s) 499, 572
XceI RCATGY 2 cut(s) 126, 357
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.