Rmu_sc0009360.1_g000055

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009360.1
Physical Location & Seq
Forward (+)
158162 .. 159687
1526 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009360.1_g000055.1.cds

Sequence Viewer

Length: 612 bp
atggccttgttatctactcttcttgttctgctacccatggctacttacgctgtggactggccttctccttctattgccgctgaagtatgtaaacatgttgattgtggaaaaggaacttgcagcttcaacaccagtgaaccattagcctatacctgcgagtgcgagaaaggatggaagcgaaccgctgaaggcaacgataatcttaagtttctcccttgtgtcatccctaactgcacactggactacaacggttgccaagctccccctaaagttcctgattacacagaagtcccacgcaacttatctgcatttgatccttgctactgggtttactgtggagaaggtacatgcgtcaagaactctacctatctatacacaccagagtgtaaatgcaactcaggggcttctaaccttcttggcatcagtgtatacccctgctacaatcaatgcacacttcaacctgactgtgctgcccttggaatcaaagtttcaaattccactagtacctctcccagtggaacgtcgactaacagtaacaaagctaccgacttcatgccaggcaaattccagttgatgactatagtgatggtgtctgtgggtatgatgctatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

203

Amino Acids

21.92

Weight (kDa)

5.1

Isoelectric Point (pI)

27.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 161
AccI GTMKAC 2 cut(s) 429, 524
AciI CCGC 2 cut(s) 78, 183
AclWI GGATC 1 cut(s) 308
AcsI RAATTY 2 cut(s) 493, 563
AcuI CTGAAG 2 cut(s) 102, 207
AfaI GTAC 2 cut(s) 346, 505
AflII CTTAAG 1 cut(s) 203
AflIII ACRYGT 1 cut(s) 94
AgsI TTSAA 3 cut(s) 127, 458, 492
AhlI ACTAGT 1 cut(s) 500
AjnI CCWGG 1 cut(s) 556
AleI CACNNNNGTG 1 cut(s) 382
AluBI AGCT 3 cut(s) 123, 260, 542
AluI AGCT 3 cut(s) 123, 260, 542
AlwI GGATC 1 cut(s) 308
AoxI GGCC 2 cut(s) 3, 59
ApeKI GCWGC 2 cut(s) 120, 470
ApoI RAATTY 2 cut(s) 493, 563
BaeI ACNNNNGTAYC 2 cut(s) 336, 369
BbvI GCAGC 2 cut(s) 132, 457
BccI CCATC 2 cut(s) 165, 580
BciT130I CCWGG 1 cut(s) 558
BcuI ACTAGT 1 cut(s) 500
BfaI CTAG 1 cut(s) 501
BfmI CTRYAG 1 cut(s) 579
BfrI CTTAAG 1 cut(s) 203
BfuAI ACCTGC 1 cut(s) 161
BisI GCNGC 3 cut(s) 78, 121, 471
BlsI GCNGC 3 cut(s) 79, 122, 472
Bme1390I CCNGG 1 cut(s) 558
BmrFI CCNGG 1 cut(s) 558
BmrI ACTGGG 2 cut(s) 334, 507
BmsI GCATC 2 cut(s) 429, 594
BmuI ACTGGG 2 cut(s) 334, 507
BsaJI CCNNGG 2 cut(s) 36, 475
Bse1I ACTGG 6 cut(s) 62, 132, 243, 329, 513, 568
BseBI CCWGG 1 cut(s) 558
BseDI CCNNGG 2 cut(s) 36, 475
BseGI GGATG 2 cut(s) 176, 222
BseMII CTCAG 1 cut(s) 411
BseNI ACTGG 6 cut(s) 62, 132, 243, 329, 513, 568
BseXI GCAGC 2 cut(s) 132, 457
BsgI GTGCAG 1 cut(s) 217
BshFI GGCC 2 cut(s) 5, 61
BslFI GGGAC 1 cut(s) 275
BsmFI GGGAC 1 cut(s) 275
BsnI GGCC 2 cut(s) 5, 61
Bsp143I GATC 1 cut(s) 313
Bsp19I CCATGG 1 cut(s) 36
BspACI CCGC 2 cut(s) 78, 183
BspANI GGCC 2 cut(s) 5, 61
BspCNI CTCAG 1 cut(s) 410
BspMI ACCTGC 1 cut(s) 161
BspPI GGATC 1 cut(s) 308
BspTI CTTAAG 1 cut(s) 203
BsrI ACTGG 6 cut(s) 62, 132, 243, 329, 513, 568
BssECI CCNNGG 2 cut(s) 36, 475
BssMI GATC 1 cut(s) 313
BssNAI GTATAC 1 cut(s) 430
BssT1I CCWWGG 2 cut(s) 36, 475
Bst1107I GTATAC 1 cut(s) 430
Bst2UI CCWGG 1 cut(s) 558
Bst4CI ACNGT 4 cut(s) 251, 335, 467, 533
Bst6I CTCTTC 1 cut(s) 24
BstAFI CTTAAG 1 cut(s) 203
BstDEI CTNAG 1 cut(s) 397
BstDSI CCRYGG 1 cut(s) 36
BstF5I GGATG 2 cut(s) 176, 222
BstKTI GATC 1 cut(s) 316
BstMBI GATC 1 cut(s) 313
BstMWI GCNNNNNNNGC 1 cut(s) 47
BstNI CCWGG 1 cut(s) 558
BstNSI RCATGY 2 cut(s) 98, 351
BstSCI CCNGG 1 cut(s) 556
BstSFI CTRYAG 1 cut(s) 579
BstV1I GCAGC 2 cut(s) 132, 457
BstZ17I GTATAC 1 cut(s) 430
BsuRI GGCC 2 cut(s) 5, 61
BtgI CCRYGG 1 cut(s) 36
BtsCI GGATG 2 cut(s) 176, 222
BtsIMutI CAGTG 4 cut(s) 139, 236, 430, 520
BveI ACCTGC 1 cut(s) 161
CseI GACGC 1 cut(s) 340
Csp6I GTAC 2 cut(s) 345, 504
CviAII CATG 4 cut(s) 37, 95, 348, 553
CviJI RGCY 8 cut(s) 5, 41, 61, 123, 146, 260, 404, 542
CviKI_1 RGCY 8 cut(s) 5, 41, 61, 123, 146, 260, 404, 542
CviQI GTAC 2 cut(s) 345, 504
DdeI CTNAG 1 cut(s) 397
DpnI GATC 1 cut(s) 315
DpnII GATC 1 cut(s) 313
Eam1104I CTCTTC 1 cut(s) 24
EarI CTCTTC 1 cut(s) 24
Eco130I CCWWGG 2 cut(s) 36, 475
Eco57I CTGAAG 2 cut(s) 102, 207
EcoRII CCWGG 1 cut(s) 556
EcoT14I CCWWGG 2 cut(s) 36, 475
ErhI CCWWGG 2 cut(s) 36, 475
FaeI CATG 4 cut(s) 40, 98, 351, 556
FaqI GGGAC 1 cut(s) 275
FatI CATG 4 cut(s) 36, 94, 347, 552
FblI GTMKAC 2 cut(s) 429, 524
Fnu4HI GCNGC 3 cut(s) 78, 121, 471
FokI GGATG 2 cut(s) 183, 209
Fsp4HI GCNGC 3 cut(s) 78, 121, 471
FspBI CTAG 1 cut(s) 501
GluI GCNGC 3 cut(s) 78, 121, 471
HaeIII GGCC 2 cut(s) 5, 61
HgaI GACGC 1 cut(s) 340
Hin1II CATG 4 cut(s) 40, 98, 351, 556
HincII GTYRAC 1 cut(s) 525
HindII GTYRAC 1 cut(s) 525
HinfI GANTC 1 cut(s) 480
Hpy166II GTNNAC 6 cut(s) 55, 92, 137, 331, 430, 525
Hpy188III TCNNGA 2 cut(s) 275, 355
Hpy8I GTNNAC 6 cut(s) 55, 92, 137, 331, 430, 525
Hpy99I CGWCG 1 cut(s) 526
HpyAV CCTTC 5 cut(s) 72, 78, 182, 335, 422
HpyCH4III ACNGT 4 cut(s) 251, 335, 467, 533
HpyCH4IV ACGT 1 cut(s) 521
HpyCH4V TGCA 5 cut(s) 120, 234, 308, 393, 450
HpyF10VI GCNNNNNNNGC 1 cut(s) 47
HpyF3I CTNAG 1 cut(s) 397
HpySE526I ACGT 1 cut(s) 521
Hsp92II CATG 4 cut(s) 40, 98, 351, 556
Kzo9I GATC 1 cut(s) 313
LmnI GCTCC 1 cut(s) 265
Lsp1109I GCAGC 2 cut(s) 132, 457
LweI GCATC 2 cut(s) 429, 594
MaeI CTAG 1 cut(s) 501
MaeII ACGT 1 cut(s) 521
MaeIII GTNAC 1 cut(s) 533
MalI GATC 1 cut(s) 315
MboI GATC 1 cut(s) 313
MboII GAAGA 1 cut(s) 11
MluCI AATT 2 cut(s) 493, 563
MnlI CCTC 1 cut(s) 517
MseI TTAA 1 cut(s) 204
MslI CAYNNNNRTG 1 cut(s) 382
MspA1I CMGCKG 2 cut(s) 80, 185
MspCI CTTAAG 1 cut(s) 203
MspR9I CCNGG 1 cut(s) 558
MvaI CCWGG 1 cut(s) 558
MwoI GCNNNNNNNGC 1 cut(s) 47
NcoI CCATGG 1 cut(s) 36
NdeII GATC 1 cut(s) 313
NlaIII CATG 4 cut(s) 40, 98, 351, 556
NspI RCATGY 2 cut(s) 98, 351
OliI CACNNNNGTG 1 cut(s) 382
PciI ACATGT 1 cut(s) 94
PfeI GAWTC 1 cut(s) 480
PkrI GCNGC 3 cut(s) 79, 122, 472
PscI ACATGT 1 cut(s) 94
Psp6I CCWGG 1 cut(s) 556
PspGI CCWGG 1 cut(s) 556
RsaI GTAC 2 cut(s) 346, 505
RsaNI GTAC 2 cut(s) 345, 504
RseI CAYNNNNRTG 1 cut(s) 382
SalI GTCGAC 1 cut(s) 523
SaqAI TTAA 1 cut(s) 204
SatI GCNGC 3 cut(s) 78, 121, 471
Sau3AI GATC 1 cut(s) 313
ScrFI CCNGG 1 cut(s) 558
SfaNI GCATC 2 cut(s) 429, 594
SfcI CTRYAG 1 cut(s) 579
SmiMI CAYNNNNRTG 1 cut(s) 382
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
SpeI ACTAGT 1 cut(s) 500
Sse9I AATT 2 cut(s) 493, 563
SsiI CCGC 2 cut(s) 78, 183
SspMI CTAG 1 cut(s) 501
StyD4I CCNGG 1 cut(s) 556
StyI CCWWGG 2 cut(s) 36, 475
TaaI ACNGT 4 cut(s) 251, 335, 467, 533
TaiI ACGT 1 cut(s) 524
TaqI TCGA 1 cut(s) 524
TasI AATT 2 cut(s) 493, 563
TauI GCSGC 1 cut(s) 80
TfiI GAWTC 1 cut(s) 480
Tru1I TTAA 1 cut(s) 204
Tru9I TTAA 1 cut(s) 204
TscAI CASTG 4 cut(s) 139, 243, 430, 520
TseI GCWGC 2 cut(s) 120, 470
TspDTI ATGAA 1 cut(s) 541
TspRI CASTG 4 cut(s) 139, 243, 430, 520
Vha464I CTTAAG 1 cut(s) 203
XapI RAATTY 2 cut(s) 493, 563
XceI RCATGY 2 cut(s) 98, 351
XmiI GTMKAC 2 cut(s) 429, 524
XspI CTAG 1 cut(s) 501
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.