Rmu_sc0002842.1_g000001
BZIP Family

BZip transcription factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002842.1
Physical Location & Seq
Reverse (-)
1 .. 3873
3873 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002842.1_g000001.1.cds

Sequence Viewer

Length: 564 bp
atggatgatgaacaaggctacaagcctccggcagattttgaagaaaatgctaaagacccagtggtcaatttcaacgtgaacgattttactgagctttggttcattcggtcttggtcttggtcttcgcctccctccctctccttgatcacaaatcttcaggtcttggtcttggtattcgcctccctccctctccttgatcacaaatcttcaggtcttggtcttggtattcgcctccaattccggcgaccaccagccccgccgtcgtctctcagatcggacccagccttcaacccgaactctgaaaaagattcgatctctctatctctcagcagcgttgacgtgatcgaagagatagattgggatttcgtattcgacgatgcgaatgggttagaattgttgcaagagttggagaacccggccatcatggcggcaactagggcttcgccttcttcattttcgtcatcaacggtggaggatgctctggccaacccgaagacgggatcgattgacatgtggattggcgaggttgaggggatgctgatgaaagacgatgacggaagcaag

Protein Analysis

188

Amino Acids

20.69

Weight (kDa)

4.14

Isoelectric Point (pI)

59.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 62
AciI CCGC 2 cut(s) 257, 428
AclWI GGATC 1 cut(s) 508
AcoI YGGCCR 2 cut(s) 417, 483
AcuI CTGAAG 2 cut(s) 140, 192
AfiI CCNNNNNNNGG 2 cut(s) 496, 497
AflIII ACRYGT 1 cut(s) 510
AgsI TTSAA 3 cut(s) 41, 73, 289
AjiI CACGTC 1 cut(s) 340
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
Alw26I GTCTC 1 cut(s) 270
AlwI GGATC 1 cut(s) 508
AoxI GGCC 2 cut(s) 417, 483
ApeKI GCWGC 1 cut(s) 330
AspS9I GGNCC 1 cut(s) 277
AsuC2I CCSGG 1 cut(s) 416
AvaII GGWCC 1 cut(s) 277
BalI TGGCCA 1 cut(s) 485
BbsI GAAGAC 2 cut(s) 114, 500
BbvI GCAGC 1 cut(s) 342
BccI CCATC 1 cut(s) 428
BceAI ACGGC 1 cut(s) 244
BclI TGATCA 2 cut(s) 144, 196
BcnI CCSGG 1 cut(s) 416
BcoDI GTCTC 1 cut(s) 270
BfaI CTAG 1 cut(s) 435
BglI GCCNNNNNGGC 1 cut(s) 425
BisI GCNGC 2 cut(s) 331, 429
BlsI GCNGC 2 cut(s) 332, 430
Bme1390I CCNGG 1 cut(s) 416
Bme18I GGWCC 1 cut(s) 277
BmgBI CACGTC 1 cut(s) 340
BmgT120I GGNCC 1 cut(s) 277
BmiI GGNNCC 1 cut(s) 279
BmrFI CCNGG 1 cut(s) 416
BmrI ACTGGG 1 cut(s) 53
BmsI GCATC 3 cut(s) 367, 466, 525
BmuI ACTGGG 1 cut(s) 53
BpiI GAAGAC 2 cut(s) 114, 500
BpuMI CCSGG 1 cut(s) 416
Bsa29I ATCGAT 1 cut(s) 503
Bsc4I CCNNNNNNNGG 2 cut(s) 496, 497
Bse1I ACTGG 1 cut(s) 59
BseCI ATCGAT 1 cut(s) 503
BseGI GGATG 3 cut(s) 10, 481, 540
BseLI CCNNNNNNNGG 2 cut(s) 496, 497
BseMII CTCAG 3 cut(s) 81, 283, 340
BseNI ACTGG 1 cut(s) 59
BseXI GCAGC 1 cut(s) 342
BseYI CCCAGC 1 cut(s) 280
BshFI GGCC 2 cut(s) 419, 485
BshVI ATCGAT 1 cut(s) 503
BsiSI CCGG 3 cut(s) 29, 241, 416
BslI CCNNNNNNNGG 2 cut(s) 496, 497
BsmAI GTCTC 1 cut(s) 270
BsmBI CGTCTC 1 cut(s) 270
BsnI GGCC 2 cut(s) 419, 485
Bsp143I GATC 6 cut(s) 144, 196, 272, 312, 342, 500
BspACI CCGC 2 cut(s) 257, 428
BspANI GGCC 2 cut(s) 419, 485
BspCNI CTCAG 3 cut(s) 82, 282, 339
BspDI ATCGAT 1 cut(s) 503
BspLI GGNNCC 1 cut(s) 279
BspPI GGATC 1 cut(s) 508
BsrI ACTGG 1 cut(s) 59
BssMI GATC 6 cut(s) 144, 196, 272, 312, 342, 500
Bst4CI ACNGT 1 cut(s) 469
Bst6I CTCTTC 1 cut(s) 342
BstDEI CTNAG 3 cut(s) 90, 269, 326
BstF5I GGATG 3 cut(s) 10, 481, 540
BstKTI GATC 6 cut(s) 147, 199, 275, 315, 345, 503
BstMAI GTCTC 1 cut(s) 270
BstMBI GATC 6 cut(s) 144, 196, 272, 312, 342, 500
BstMWI GCNNNNNNNGC 2 cut(s) 425, 437
BstNSI RCATGY 1 cut(s) 514
BstSCI CCNGG 1 cut(s) 414
BstV1I GCAGC 1 cut(s) 342
BstV2I GAAGAC 2 cut(s) 114, 500
Bsu15I ATCGAT 1 cut(s) 503
BsuRI GGCC 2 cut(s) 419, 485
BsuTUI ATCGAT 1 cut(s) 503
BtrI CACGTC 1 cut(s) 340
BtsCI GGATG 3 cut(s) 10, 481, 540
BtsIMutI CAGTG 1 cut(s) 66
Cfr13I GGNCC 1 cut(s) 277
ClaI ATCGAT 1 cut(s) 503
CviAII CATG 2 cut(s) 424, 511
CviJI RGCY 8 cut(s) 18, 25, 94, 254, 284, 419, 440, 485
CviKI_1 RGCY 8 cut(s) 18, 25, 94, 254, 284, 419, 440, 485
DdeI CTNAG 3 cut(s) 90, 269, 326
DpnI GATC 6 cut(s) 146, 198, 274, 314, 344, 502
DpnII GATC 6 cut(s) 144, 196, 272, 312, 342, 500
DrdI GACNNNNNNGTC 1 cut(s) 62
DseDI GACNNNNNNGTC 1 cut(s) 62
EaeI YGGCCR 2 cut(s) 417, 483
Eam1104I CTCTTC 1 cut(s) 342
EarI CTCTTC 1 cut(s) 342
Eco47I GGWCC 1 cut(s) 277
Eco57I CTGAAG 2 cut(s) 140, 192
Esp3I CGTCTC 1 cut(s) 270
FaeI CATG 2 cut(s) 427, 514
FaiI YATR 2 cut(s) 425, 512
FatI CATG 2 cut(s) 423, 510
FauI CCCGC 1 cut(s) 264
FbaI TGATCA 2 cut(s) 144, 196
Fnu4HI GCNGC 2 cut(s) 331, 429
FokI GGATG 3 cut(s) 17, 488, 547
Fsp4HI GCNGC 2 cut(s) 331, 429
FspBI CTAG 1 cut(s) 435
GluI GCNGC 2 cut(s) 331, 429
GsaI CCCAGC 1 cut(s) 284
HaeIII GGCC 2 cut(s) 419, 485
HapII CCGG 3 cut(s) 29, 241, 416
Hin1II CATG 2 cut(s) 427, 514
HincII GTYRAC 1 cut(s) 337
HindII GTYRAC 1 cut(s) 337
HinfI GANTC 1 cut(s) 308
HpaII CCGG 3 cut(s) 29, 241, 416
Hpy166II GTNNAC 2 cut(s) 79, 337
Hpy188I TCNGA 3 cut(s) 272, 277, 301
Hpy8I GTNNAC 2 cut(s) 79, 337
Hpy99I CGWCG 2 cut(s) 265, 377
HpyAV CCTTC 2 cut(s) 295, 456
HpyCH4III ACNGT 1 cut(s) 469
HpyCH4IV ACGT 2 cut(s) 75, 339
HpyCH4V TGCA 1 cut(s) 400
HpyF10VI GCNNNNNNNGC 2 cut(s) 425, 437
HpyF3I CTNAG 3 cut(s) 90, 269, 326
HpySE526I ACGT 2 cut(s) 75, 339
Hsp92II CATG 2 cut(s) 427, 514
Ksp22I TGATCA 2 cut(s) 144, 196
Kzo9I GATC 6 cut(s) 144, 196, 272, 312, 342, 500
LpnPI CCDG 9 cut(s) 42, 72, 143, 195, 254, 264, 294, 429, 467
Lsp1109I GCAGC 1 cut(s) 342
LweI GCATC 3 cut(s) 367, 466, 525
MaeI CTAG 1 cut(s) 435
MaeII ACGT 2 cut(s) 75, 339
MalI GATC 6 cut(s) 146, 198, 274, 314, 344, 502
MboI GATC 6 cut(s) 144, 196, 272, 312, 342, 500
MboII GAAGA 7 cut(s) 53, 114, 146, 198, 359, 441, 505
MlsI TGGCCA 1 cut(s) 485
MluCI AATT 3 cut(s) 67, 236, 392
MluNI TGGCCA 1 cut(s) 485
MmeI TCCRAC 1 cut(s) 387
Mox20I TGGCCA 1 cut(s) 485
MscI TGGCCA 1 cut(s) 485
Msp20I TGGCCA 1 cut(s) 485
MspI CCGG 3 cut(s) 29, 241, 416
MspR9I CCNGG 1 cut(s) 416
MwoI GCNNNNNNNGC 2 cut(s) 425, 437
NciI CCSGG 1 cut(s) 416
NdeII GATC 6 cut(s) 144, 196, 272, 312, 342, 500
NlaIII CATG 2 cut(s) 427, 514
NlaIV GGNNCC 1 cut(s) 279
NspI RCATGY 1 cut(s) 514
PciI ACATGT 1 cut(s) 510
PcsI WCGNNNNNNNCGW 1 cut(s) 372
PfeI GAWTC 1 cut(s) 308
PkrI GCNGC 2 cut(s) 332, 430
PscI ACATGT 1 cut(s) 510
PspFI CCCAGC 1 cut(s) 280
PspN4I GGNNCC 1 cut(s) 279
PspPI GGNCC 1 cut(s) 277
SatI GCNGC 2 cut(s) 331, 429
Sau3AI GATC 6 cut(s) 144, 196, 272, 312, 342, 500
Sau96I GGNCC 1 cut(s) 277
ScrFI CCNGG 1 cut(s) 416
SetI ASST 6 cut(s) 78, 96, 162, 214, 342, 528
SfaNI GCATC 3 cut(s) 367, 466, 525
SinI GGWCC 1 cut(s) 277
Sse9I AATT 3 cut(s) 67, 236, 392
SsiI CCGC 2 cut(s) 257, 428
SspMI CTAG 1 cut(s) 435
StyD4I CCNGG 1 cut(s) 414
TaaI ACNGT 1 cut(s) 469
TaiI ACGT 2 cut(s) 78, 342
TaqI TCGA 4 cut(s) 311, 345, 372, 503
TaqII GACCGA 1 cut(s) 96
TasI AATT 3 cut(s) 67, 236, 392
TauI GCSGC 1 cut(s) 431
TfiI GAWTC 1 cut(s) 308
TscAI CASTG 1 cut(s) 66
TseI GCWGC 1 cut(s) 330
TspDTI ATGAA 4 cut(s) 24, 91, 441, 557
TspRI CASTG 1 cut(s) 66
VpaK11BI GGWCC 1 cut(s) 277
XceI RCATGY 1 cut(s) 514
XspI CTAG 1 cut(s) 435
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.