Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002853.1

Orthogroup ID

OG0006430

Physical Location & Seq

Genomic Coordinates Forward (+)

62009 .. 62353

Gene Structure 345 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002853.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 345 bp

atggctcctcccagtattctcgatcctccggagttccacaaaccctcacccaccaccaccgctccgccgccaccccaacccaaatccaaacccatcaccggcgaacccttcgtggacctgatggtggtgaatttcaacgacgtcggaaccaagcacgacctcccaatgggcctgacggagaacgactctgccatgtttctctccaccggcaacccctgcctcgatctcttcttccacatcatcccgaacactccaggtgactacctcaccgatgggactccaatggtggccagtgtcgtgtcattggcttcttcctttatcgcagtcactttatcatcttcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF2828

Protein Analysis

114

Amino Acids

12.07

Weight (kDa)

4.42

Isoelectric Point (pI)

44.72

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006430)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0065551 RchiOBHm_Chr7g0210331
rosa_laevigata	RLG00000013135
rosa_multiflora	Rmu_sc0000573.1_g000032 Rmu_sc0002482.1_g000022 Rmu_sc0002853.1_g000007 Rmu_sc0004465.1_g000025 Rmu_sc0008877.1_g000005 Rmu_sc0012973.1_g000003 Rmu_sc0025057.1_g000001
rosa_roxburghii	Rroxscaffold_2G00086520 Rroxscaffold_3G00227130 Rroxscaffold_5G00377700
rosa_rugosa	Rorug01G0061800
rosa_samantha	Rh1AG059300 Rh1AG069300 Rh1AG241800 Rh1BG052700 Rh1CG225600 Rh1CG299900 Rh2BG263100 Rh2CG584100 Rh3BG245100 Rh4BG041800 Rh5AG536800 Rh6AG270100 Rh6BG090500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	144
AccBSI	CCGCTC	1 cut(s)	62
AccIII	TCCGGA	1 cut(s)	28
AciI	CCGC	3 cut(s)	60, 65, 68
AclWI	GGATC	1 cut(s)	17
AcoI	YGGCCR	1 cut(s)	288
AcsI	RAATTY	1 cut(s)	130
AcyI	GRCGYC	1 cut(s)	141
AfiI	CCNNNNNNNGG	3 cut(s)	98, 124, 166
AgsI	TTSAA	1 cut(s)	136
AjnI	CCWGG	1 cut(s)	253
AlwI	GGATC	1 cut(s)	17
Aor13HI	TCCGGA	1 cut(s)	28
AoxI	GGCC	2 cut(s)	169, 288
ApoI	RAATTY	1 cut(s)	130
AspS9I	GGNCC	2 cut(s)	115, 169
AsuHPI	GGTGA	5 cut(s)	39, 88, 139, 259, 269
AvaII	GGWCC	1 cut(s)	115
BalI	TGGCCA	1 cut(s)	290
BccI	CCATC	3 cut(s)	101, 115, 266
BciT130I	CCWGG	1 cut(s)	255
BisI	GCNGC	1 cut(s)	68
BlsI	GCNGC	1 cut(s)	69
Bme1390I	CCNGG	1 cut(s)	255
Bme18I	GGWCC	1 cut(s)	115
BmgT120I	GGNCC	2 cut(s)	115, 169
BmiI	GGNNCC	2 cut(s)	6, 148
BmrFI	CCNGG	1 cut(s)	255
BmrI	ACTGGG	1 cut(s)	6
BmuI	ACTGGG	1 cut(s)	6
BplI	GAGNNNNNCTC	2 cut(s)	170, 202
BpmI	CTGGAG	1 cut(s)	237
BsaHI	GRCGYC	1 cut(s)	141
BsaWI	WCCGGW	1 cut(s)	28
BsaXI	ACNNNNNCTCC	2 cut(s)	46, 76
Bsc4I	CCNNNNNNNGG	3 cut(s)	98, 124, 166
Bse118I	RCCGGY	2 cut(s)	98, 206
Bse1I	ACTGG	2 cut(s)	12, 291
BseAI	TCCGGA	1 cut(s)	28
BseBI	CCWGG	1 cut(s)	255
BseGI	GGATG	1 cut(s)	240
BseLI	CCNNNNNNNGG	3 cut(s)	98, 124, 166
BseNI	ACTGG	2 cut(s)	12, 291
BshFI	GGCC	2 cut(s)	171, 290
BsiSI	CCGG	3 cut(s)	29, 99, 207
BslFI	GGGAC	1 cut(s)	289
BslI	CCNNNNNNNGG	3 cut(s)	98, 124, 166
BsmFI	GGGAC	1 cut(s)	289
BsnI	GGCC	2 cut(s)	171, 290
Bsp13I	TCCGGA	1 cut(s)	28
Bsp143I	GATC	2 cut(s)	22, 223
BspACI	CCGC	3 cut(s)	60, 65, 68
BspANI	GGCC	2 cut(s)	171, 290
BspEI	TCCGGA	1 cut(s)	28
BspLI	GGNNCC	2 cut(s)	6, 148
BspPI	GGATC	1 cut(s)	17
BsrBI	CCGCTC	1 cut(s)	62
BsrFI	RCCGGY	2 cut(s)	98, 206
BsrI	ACTGG	2 cut(s)	12, 291
BssAI	RCCGGY	2 cut(s)	98, 206
BssMI	GATC	2 cut(s)	22, 223
BssNI	GRCGYC	1 cut(s)	141
Bst2UI	CCWGG	1 cut(s)	255
Bst6I	CTCTTC	1 cut(s)	233
BstACI	GRCGYC	1 cut(s)	141
BstAPI	GCANNNNNTGC	1 cut(s)	216
BstF5I	GGATG	1 cut(s)	240
BstKTI	GATC	2 cut(s)	25, 226
BstMBI	GATC	2 cut(s)	22, 223
BstMWI	GCNNNNNNNGC	1 cut(s)	216
BstNI	CCWGG	1 cut(s)	255
BstSCI	CCNGG	1 cut(s)	253
BsuRI	GGCC	2 cut(s)	171, 290
BtsCI	GGATG	1 cut(s)	240
BtsIMutI	CAGTG	1 cut(s)	298
Cfr10I	RCCGGY	2 cut(s)	98, 206
Cfr13I	GGNCC	2 cut(s)	115, 169
CviAII	CATG	1 cut(s)	193
CviJI	RGCY	4 cut(s)	5, 171, 290, 308
CviKI_1	RGCY	4 cut(s)	5, 171, 290, 308
DpnI	GATC	2 cut(s)	24, 225
DpnII	GATC	2 cut(s)	22, 223
EaeI	YGGCCR	1 cut(s)	288
Eam1104I	CTCTTC	1 cut(s)	233
EarI	CTCTTC	1 cut(s)	233
EciI	GGCGGA	1 cut(s)	54
Eco47I	GGWCC	1 cut(s)	115
EcoRII	CCWGG	1 cut(s)	253
FaeI	CATG	1 cut(s)	196
FaiI	YATR	1 cut(s)	194
FaqI	GGGAC	1 cut(s)	289
FatI	CATG	1 cut(s)	192
Fnu4HI	GCNGC	1 cut(s)	68
FokI	GGATG	1 cut(s)	227
Fsp4HI	GCNGC	1 cut(s)	68
GluI	GCNGC	1 cut(s)	68
GsuI	CTGGAG	1 cut(s)	237
HaeIII	GGCC	2 cut(s)	171, 290
HapII	CCGG	3 cut(s)	29, 99, 207
Hin1I	GRCGYC	1 cut(s)	141
Hin1II	CATG	1 cut(s)	196
HinfI	GANTC	2 cut(s)	185, 277
HpaII	CCGG	3 cut(s)	29, 99, 207
HphI	GGTGA	5 cut(s)	39, 88, 139, 259, 269
Hpy166II	GTNNAC	1 cut(s)	115
Hpy188I	TCNGA	1 cut(s)	146
Hpy188III	TCNNGA	4 cut(s)	20, 29, 244, 342
Hpy8I	GTNNAC	1 cut(s)	115
Hpy99I	CGWCG	2 cut(s)	143, 146
HpyAV	CCTTC	1 cut(s)	118
HpyCH4IV	ACGT	1 cut(s)	141
HpyF10VI	GCNNNNNNNGC	1 cut(s)	216
HpySE526I	ACGT	1 cut(s)	141
Hsp92I	GRCGYC	1 cut(s)	141
Hsp92II	CATG	1 cut(s)	196
Kpn2I	TCCGGA	1 cut(s)	28
Kzo9I	GATC	2 cut(s)	22, 223
LmnI	GCTCC	2 cut(s)	10, 67
MaeII	ACGT	1 cut(s)	141
MaeIII	GTNAC	2 cut(s)	257, 325
MalI	GATC	2 cut(s)	24, 225
MbiI	CCGCTC	1 cut(s)	62
MboI	GATC	2 cut(s)	22, 223
MboII	GAAGA	4 cut(s)	220, 223, 303, 330
MlsI	TGGCCA	1 cut(s)	290
MluCI	AATT	1 cut(s)	130
MluNI	TGGCCA	1 cut(s)	290
MlyI	GAGTC	2 cut(s)	179, 271
MmeI	TCCRAC	1 cut(s)	124
MnlI	CCTC	6 cut(s)	18, 36, 55, 170, 230, 275
Mox20I	TGGCCA	1 cut(s)	290
MroI	TCCGGA	1 cut(s)	28
MscI	TGGCCA	1 cut(s)	290
Msp20I	TGGCCA	1 cut(s)	290
MspI	CCGG	3 cut(s)	29, 99, 207
MspR9I	CCNGG	1 cut(s)	255
MvaI	CCWGG	1 cut(s)	255
MwoI	GCNNNNNNNGC	1 cut(s)	216
NdeII	GATC	2 cut(s)	22, 223
NlaIII	CATG	1 cut(s)	196
NlaIV	GGNNCC	2 cut(s)	6, 148
NmuCI	GTSAC	2 cut(s)	257, 325
PkrI	GCNGC	1 cut(s)	69
PleI	GAGTC	2 cut(s)	179, 271
PpsI	GAGTC	2 cut(s)	179, 271
Psp6I	CCWGG	1 cut(s)	253
PspGI	CCWGG	1 cut(s)	253
PspN4I	GGNNCC	2 cut(s)	6, 148
PspPI	GGNCC	2 cut(s)	115, 169
SatI	GCNGC	1 cut(s)	68
Sau3AI	GATC	2 cut(s)	22, 223
Sau96I	GGNCC	2 cut(s)	115, 169
SchI	GAGTC	2 cut(s)	179, 271
ScrFI	CCNGG	1 cut(s)	255
SetI	ASST	5 cut(s)	120, 144, 162, 259, 267
SgrAI	CRCCGGYG	1 cut(s)	98
SinI	GGWCC	1 cut(s)	115
Sse9I	AATT	1 cut(s)	130
SsiI	CCGC	3 cut(s)	60, 65, 68
StyD4I	CCNGG	1 cut(s)	253
TaiI	ACGT	1 cut(s)	144
TaqI	TCGA	2 cut(s)	21, 222
TasI	AATT	1 cut(s)	130
TauI	GCSGC	1 cut(s)	70
TscAI	CASTG	1 cut(s)	298
TseFI	GTSAC	2 cut(s)	257, 325
Tsp45I	GTSAC	2 cut(s)	257, 325
TspGWI	ACGGA	1 cut(s)	191
TspRI	CASTG	1 cut(s)	298
VpaK11BI	GGWCC	1 cut(s)	115
XapI	RAATTY	1 cut(s)	130
ZraI	GACGTC	1 cut(s)	142

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.