Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004465.1

Orthogroup ID

OG0006430

Physical Location & Seq

Genomic Coordinates Forward (+)

102417 .. 103093

Gene Structure 677 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004465.1_g000025.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 474 bp

ctgtctgaggaggacttcacaccaaagtctagccagtctacggttgttaggcttcctggtcttggctcgaagagggttggcttgtttgggcttggacaatttgattcgtctacagaagcttttaagggtcttggggaggctgctgcagcagcggcaaagactgctcaagcaagtgatattgctattgtgcttgcttcctcggaggggctttctgctaaatcttgcaaagcttctgcgatatcatctggagctgttttgggtatatatgaagacaataggtataaatctgagtcaaagaaatcagctcttaagtctgtggacattcttggtcttggaactggcctgaacttgagaagaagctcaagatgttgcttctggaataatatttgggaaagagctcacgaattcacctgccaatgttctcacacctgggaaactagcagaagaggcctaaaaaattgcttccttatatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000287 GO:0003674 GO:0003824 GO:0004177 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0007275 GO:0007568 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0010035 GO:0010038 GO:0010150 GO:0016787 GO:0016805 GO:0019538 GO:0030145 GO:0032501 GO:0032502 GO:0042221 GO:0043167 GO:0043169 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0046686 GO:0046872 GO:0046914 GO:0048366 GO:0048367 GO:0048731 GO:0048827 GO:0048856 GO:0050896 GO:0070011 GO:0071704 GO:0090693 GO:0099402 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko00230 ko00240 ko00480 ko01100 ko03020 ko05016 ko05169 map00230 map00240 map00480 map01100 map03020 map05016 map05169

Pfam Domains

Protein Families

Peptidase_M17 Peptidase_M17_N

Protein Analysis

157

Amino Acids

16.8

Weight (kDa)

8.97

Isoelectric Point (pI)

43.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006430)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0065551 RchiOBHm_Chr7g0210331
rosa_laevigata	RLG00000013135
rosa_multiflora	Rmu_sc0000573.1_g000032 Rmu_sc0002482.1_g000022 Rmu_sc0002853.1_g000007 Rmu_sc0004465.1_g000025 Rmu_sc0008877.1_g000005 Rmu_sc0012973.1_g000003 Rmu_sc0025057.1_g000001
rosa_roxburghii	Rroxscaffold_2G00086520 Rroxscaffold_3G00227130 Rroxscaffold_5G00377700
rosa_rugosa	Rorug01G0061800
rosa_samantha	Rh1AG059300 Rh1AG069300 Rh1AG241800 Rh1BG052700 Rh1CG225600 Rh1CG299900 Rh2BG263100 Rh2CG584100 Rh3BG245100 Rh4BG041800 Rh5AG536800 Rh6AG270100 Rh6BG090500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	419
Acc36I	ACCTGC	1 cut(s)	419
AccI	GTMKAC	2 cut(s)	38, 110
AciI	CCGC	1 cut(s)	152
AcsI	RAATTY	1 cut(s)	404
AfiI	CCNNNNNNNGG	3 cut(s)	40, 62, 204
AflII	CTTAAG	1 cut(s)	308
AjnI	CCWGG	2 cut(s)	55, 428
AluBI	AGCT	6 cut(s)	119, 230, 251, 305, 360, 398
AluI	AGCT	6 cut(s)	119, 230, 251, 305, 360, 398
Alw21I	GWGCWC	1 cut(s)	400
AoxI	GGCC	2 cut(s)	340, 448
ApeKI	GCWGC	4 cut(s)	140, 143, 146, 149
ApoI	RAATTY	1 cut(s)	404
AsuHPI	GGTGA	1 cut(s)	400
BanII	GRGCYC	1 cut(s)	400
BbsI	GAAGAC	1 cut(s)	276
Bbv12I	GWGCWC	1 cut(s)	400
BbvI	GCAGC	4 cut(s)	127, 130, 158, 161
BciT130I	CCWGG	2 cut(s)	57, 430
BfaI	CTAG	2 cut(s)	30, 438
BfmI	CTRYAG	2 cut(s)	111, 144
BfrI	CTTAAG	1 cut(s)	308
BfuAI	ACCTGC	1 cut(s)	419
BisI	GCNGC	5 cut(s)	141, 144, 147, 150, 153
BlsI	GCNGC	5 cut(s)	142, 145, 148, 151, 154
Bme1390I	CCNGG	2 cut(s)	57, 430
BmrFI	CCNGG	2 cut(s)	57, 430
BpiI	GAAGAC	1 cut(s)	276
BpmI	CTGGAG	1 cut(s)	267
BpuEI	CTTGAG	3 cut(s)	150, 346, 370
BsaJI	CCNNGG	2 cut(s)	198, 429
Bsc4I	CCNNNNNNNGG	3 cut(s)	40, 62, 204
Bse1I	ACTGG	2 cut(s)	34, 343
BseBI	CCWGG	2 cut(s)	57, 430
BseDI	CCNNGG	2 cut(s)	198, 429
BseLI	CCNNNNNNNGG	3 cut(s)	40, 62, 204
BseMII	CTCAG	1 cut(s)	279
BseNI	ACTGG	2 cut(s)	34, 343
BseRI	GAGGAG	1 cut(s)	23
BseXI	GCAGC	4 cut(s)	127, 130, 158, 161
BshFI	GGCC	2 cut(s)	342, 450
BsiHKAI	GWGCWC	1 cut(s)	400
BslI	CCNNNNNNNGG	3 cut(s)	40, 62, 204
BsnI	GGCC	2 cut(s)	342, 450
Bsp1286I	GDGCHC	1 cut(s)	400
BspACI	CCGC	1 cut(s)	152
BspANI	GGCC	2 cut(s)	342, 450
BspCNI	CTCAG	1 cut(s)	280
BspMAI	CTGCAG	1 cut(s)	148
BspMI	ACCTGC	1 cut(s)	419
BspTI	CTTAAG	1 cut(s)	308
BsrI	ACTGG	2 cut(s)	34, 343
BssECI	CCNNGG	2 cut(s)	198, 429
Bst2UI	CCWGG	2 cut(s)	57, 430
Bst4CI	ACNGT	1 cut(s)	43
Bst6I	CTCTTC	2 cut(s)	65, 439
BstAFI	CTTAAG	1 cut(s)	308
BstAPI	GCANNNNNTGC	1 cut(s)	161
BstC8I	GCNNGC	1 cut(s)	192
BstDEI	CTNAG	2 cut(s)	6, 288
BstMWI	GCNNNNNNNGC	5 cut(s)	146, 149, 152, 161, 447
BstNI	CCWGG	2 cut(s)	57, 430
BstSCI	CCNGG	2 cut(s)	55, 428
BstSFI	CTRYAG	2 cut(s)	111, 144
BstV1I	GCAGC	4 cut(s)	127, 130, 158, 161
BstV2I	GAAGAC	1 cut(s)	276
BsuRI	GGCC	2 cut(s)	342, 450
BveI	ACCTGC	1 cut(s)	419
Cac8I	GCNNGC	1 cut(s)	192
DdeI	CTNAG	2 cut(s)	6, 288
Eam1104I	CTCTTC	2 cut(s)	65, 439
EarI	CTCTTC	2 cut(s)	65, 439
Ecl136II	GAGCTC	1 cut(s)	398
Eco147I	AGGCCT	1 cut(s)	450
Eco24I	GRGCYC	1 cut(s)	400
Eco32I	GATATC	1 cut(s)	240
Eco53kI	GAGCTC	1 cut(s)	398
EcoICRI	GAGCTC	1 cut(s)	398
EcoRI	GAATTC	1 cut(s)	404
EcoRII	CCWGG	2 cut(s)	55, 428
EcoRV	GATATC	1 cut(s)	240
EcoT38I	GRGCYC	1 cut(s)	400
FaiI	YATR	6 cut(s)	263, 265, 267, 282, 470, 472
FblI	GTMKAC	2 cut(s)	38, 110
Fnu4HI	GCNGC	5 cut(s)	141, 144, 147, 150, 153
FriOI	GRGCYC	1 cut(s)	400
Fsp4HI	GCNGC	5 cut(s)	141, 144, 147, 150, 153
FspBI	CTAG	2 cut(s)	30, 438
GluI	GCNGC	5 cut(s)	141, 144, 147, 150, 153
GsuI	CTGGAG	1 cut(s)	267
HaeIII	GGCC	2 cut(s)	342, 450
HindIII	AAGCTT	2 cut(s)	117, 228
HinfI	GANTC	2 cut(s)	104, 290
HphI	GGTGA	1 cut(s)	400
Hpy166II	GTNNAC	3 cut(s)	39, 111, 319
Hpy188I	TCNGA	3 cut(s)	7, 202, 289
Hpy188III	TCNNGA	4 cut(s)	246, 363, 376, 401
Hpy8I	GTNNAC	3 cut(s)	39, 111, 319
HpyCH4III	ACNGT	1 cut(s)	43
HpyCH4V	TGCA	2 cut(s)	146, 225
HpyF10VI	GCNNNNNNNGC	5 cut(s)	146, 149, 152, 161, 447
HpyF3I	CTNAG	2 cut(s)	6, 288
LmnI	GCTCC	1 cut(s)	248
Lsp1109I	GCAGC	4 cut(s)	127, 130, 158, 161
MaeI	CTAG	2 cut(s)	30, 438
MboII	GAAGA	4 cut(s)	82, 281, 366, 456
MhlI	GDGCHC	1 cut(s)	400
MluCI	AATT	3 cut(s)	98, 404, 457
MlyI	GAGTC	1 cut(s)	299
MnlI	CCTC	6 cut(s)	4, 66, 130, 196, 208, 440
MseI	TTAA	2 cut(s)	123, 309
MspA1I	CMGCKG	1 cut(s)	152
MspCI	CTTAAG	1 cut(s)	308
MspR9I	CCNGG	2 cut(s)	57, 430
MvaI	CCWGG	2 cut(s)	57, 430
MwoI	GCNNNNNNNGC	5 cut(s)	146, 149, 152, 161, 447
PaqCI	CACCTGC	1 cut(s)	419
PceI	AGGCCT	1 cut(s)	450
PfeI	GAWTC	1 cut(s)	104
PkrI	GCNGC	5 cut(s)	142, 145, 148, 151, 154
PleI	GAGTC	1 cut(s)	298
PpsI	GAGTC	1 cut(s)	298
Psp124BI	GAGCTC	1 cut(s)	400
Psp6I	CCWGG	2 cut(s)	55, 428
PspGI	CCWGG	2 cut(s)	55, 428
PstI	CTGCAG	1 cut(s)	148
SacI	GAGCTC	1 cut(s)	400
SaqAI	TTAA	2 cut(s)	123, 309
SatI	GCNGC	5 cut(s)	141, 144, 147, 150, 153
SchI	GAGTC	1 cut(s)	299
ScrFI	CCNGG	2 cut(s)	57, 430
SduI	GDGCHC	1 cut(s)	400
SetI	ASST	9 cut(s)	121, 232, 253, 281, 307, 362, 400, 413, 431
SfcI	CTRYAG	2 cut(s)	111, 144
SmlI	CTYRAG	4 cut(s)	165, 308, 349, 361
SmoI	CTYRAG	4 cut(s)	165, 308, 349, 361
Sse9I	AATT	3 cut(s)	98, 404, 457
SseBI	AGGCCT	1 cut(s)	450
SsiI	CCGC	1 cut(s)	152
SspI	AATATT	1 cut(s)	385
SspMI	CTAG	2 cut(s)	30, 438
SstI	GAGCTC	1 cut(s)	400
StuI	AGGCCT	1 cut(s)	450
StyD4I	CCNGG	2 cut(s)	55, 428
TaaI	ACNGT	1 cut(s)	43
TaqI	TCGA	1 cut(s)	68
TasI	AATT	3 cut(s)	98, 404, 457
TauI	GCSGC	1 cut(s)	155
TfiI	GAWTC	1 cut(s)	104
Tru1I	TTAA	2 cut(s)	123, 309
Tru9I	TTAA	2 cut(s)	123, 309
TseI	GCWGC	4 cut(s)	140, 143, 146, 149
TspDTI	ATGAA	1 cut(s)	282
Vha464I	CTTAAG	1 cut(s)	308
XapI	RAATTY	1 cut(s)	404
XmiI	GTMKAC	2 cut(s)	38, 110
XspI	CTAG	2 cut(s)	30, 438

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.