Rmu_sc0002934.1_g000038

Syntaxin

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002934.1
Physical Location & Seq
Forward (+)
150207 .. 151097
891 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002934.1_g000038.1.cds

Sequence Viewer

Length: 891 bp
atgaatgatctaatgaccaagtcgttcctcagttacgttgatcttaagaaacaggccatgaaagacattgaagcagaacctgacttggaaatggggaaacttgagcctgctgaagaacagaatcttgcgaaattttttgaagaagtgaaggcaatcaaggctgacatggaagagattacgaacctgcttcttgatcttcaggacctgaatgaagaaaccaagtccactcacagtgctaaagttctcagggggctgagagaccgaatcaatgctgacatggttagtattctgaggaaagctaagaacattaaagcaagattggaatcgcttgatcagtctaatattgctaaccgagaggtggctgggtacaaggaaggaagtcctgttgatcgaatgaggatttctgtgactggtggactgagagtcaagctgagagatatgatgaatgattttctggcattgagagaacagattgttaaggagcacaaagacggtctcaagagaaggtactataatgccaccggagaggaagcaactgaagaagtgatagagaagattttgagaagtggggaggtcagagtttttgaagggaaaacagagctggtgatggaaaatcaggaaagagatgaggccttgaaggacttaaagagaagcttgacagaactgcatcaagttttcctggacatggcggtgttggttgaagcacaaggtgaacagattaatgatatcgaaaagaatgtggcggatgctgggatttacataagtggtggaaacaaggaacttcttcatgcaaagcagttgaaaaagaaaaggggaaagtgggtttgttggattatggctttcgtgctggtggtgttatttgtgtgctttatttccatcatagcttcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

296

Amino Acids

33.8

Weight (kDa)

5.67

Isoelectric Point (pI)

44.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 192
AciI CCGC 2 cut(s) 689, 743
AcsI RAATTY 1 cut(s) 131
AcuI CTGAAG 3 cut(s) 132, 182, 558
AdeI CACNNNGTG 1 cut(s) 710
AfaI GTAC 2 cut(s) 368, 509
AfiI CCNNNNNNNGG 2 cut(s) 358, 685
AflII CTTAAG 1 cut(s) 44
AgsI TTSAA 6 cut(s) 71, 140, 587, 637, 701, 802
AhdI GACNNNNNGTC 1 cut(s) 422
AjnI CCWGG 1 cut(s) 678
AluBI AGCT 5 cut(s) 299, 430, 601, 654, 884
AluI AGCT 5 cut(s) 299, 430, 601, 654, 884
Alw21I GWGCWC 1 cut(s) 486
Alw26I GTCTC 2 cut(s) 252, 500
AlwNI CAGNNNCTG 2 cut(s) 80, 205
AoxI GGCC 2 cut(s) 54, 630
ApoI RAATTY 1 cut(s) 131
AseI ATTAAT 1 cut(s) 720
Asp700I GAANNNNTTC 1 cut(s) 783
AspS9I GGNCC 1 cut(s) 202
AsuHPI GGTGA 2 cut(s) 616, 722
AvaII GGWCC 1 cut(s) 202
Bbv12I GWGCWC 1 cut(s) 486
BccI CCATC 2 cut(s) 601, 884
BciT130I CCWGG 1 cut(s) 680
BclI TGATCA 1 cut(s) 331
BcoDI GTCTC 2 cut(s) 252, 500
BfrI CTTAAG 1 cut(s) 44
BfuAI ACCTGC 1 cut(s) 192
Bme1390I CCNGG 1 cut(s) 680
Bme18I GGWCC 1 cut(s) 202
BmeRI GACNNNNNGTC 1 cut(s) 422
BmgT120I GGNCC 1 cut(s) 202
BmrFI CCNGG 1 cut(s) 680
BmsI GCATC 2 cut(s) 676, 736
BpuEI CTTGAG 2 cut(s) 122, 482
BsaBI GATNNNNATC 1 cut(s) 322
BsaI GGTCTC 2 cut(s) 252, 500
BsaWI WCCGGW 1 cut(s) 521
Bsc4I CCNNNNNNNGG 2 cut(s) 358, 685
Bse1I ACTGG 1 cut(s) 415
Bse8I GATNNNNATC 1 cut(s) 322
BseBI CCWGG 1 cut(s) 680
BseGI GGATG 1 cut(s) 751
BseJI GATNNNNATC 1 cut(s) 322
BseLI CCNNNNNNNGG 2 cut(s) 358, 685
BseMII CTCAG 6 cut(s) 43, 245, 259, 281, 410, 422
BseNI ACTGG 1 cut(s) 415
BseYI CCCAGC 2 cut(s) 362, 749
BshFI GGCC 2 cut(s) 56, 632
BsiHKAI GWGCWC 1 cut(s) 486
BsiSI CCGG 1 cut(s) 522
BslI CCNNNNNNNGG 2 cut(s) 358, 685
BsmAI GTCTC 2 cut(s) 252, 500
BsnI GGCC 2 cut(s) 56, 632
Bso31I GGTCTC 2 cut(s) 252, 500
Bsp1286I GDGCHC 1 cut(s) 486
Bsp143I GATC 5 cut(s) 7, 40, 193, 331, 388
BspACI CCGC 2 cut(s) 689, 743
BspANI GGCC 2 cut(s) 56, 632
BspCNI CTCAG 6 cut(s) 42, 246, 258, 282, 411, 423
BspMI ACCTGC 1 cut(s) 192
BspTI CTTAAG 1 cut(s) 44
BspTNI GGTCTC 2 cut(s) 252, 500
BsrI ACTGG 1 cut(s) 415
BssMI GATC 5 cut(s) 7, 40, 193, 331, 388
Bst2UI CCWGG 1 cut(s) 680
Bst4CI ACNGT 2 cut(s) 233, 494
Bst6I CTCTTC 1 cut(s) 165
BstAFI CTTAAG 1 cut(s) 44
BstC8I GCNNGC 1 cut(s) 108
BstDEI CTNAG 7 cut(s) 29, 245, 254, 290, 300, 419, 431
BstF5I GGATG 1 cut(s) 751
BstKTI GATC 5 cut(s) 10, 43, 196, 334, 391
BstMAI GTCTC 2 cut(s) 252, 500
BstMBI GATC 5 cut(s) 7, 40, 193, 331, 388
BstMWI GCNNNNNNNGC 1 cut(s) 158
BstNI CCWGG 1 cut(s) 680
BstSCI CCNGG 1 cut(s) 678
BsuRI GGCC 2 cut(s) 56, 632
BtsCI GGATG 1 cut(s) 751
BtsIMutI CAGTG 1 cut(s) 238
BveI ACCTGC 1 cut(s) 192
Cac8I GCNNGC 1 cut(s) 108
CaiI CAGNNNCTG 2 cut(s) 80, 205
Cfr13I GGNCC 1 cut(s) 202
Csp6I GTAC 2 cut(s) 367, 508
CviAII CATG 5 cut(s) 58, 166, 277, 685, 788
CviQI GTAC 2 cut(s) 367, 508
DdeI CTNAG 7 cut(s) 29, 245, 254, 290, 300, 419, 431
DpnI GATC 5 cut(s) 9, 42, 195, 333, 390
DpnII GATC 5 cut(s) 7, 40, 193, 331, 388
DraIII CACNNNGTG 1 cut(s) 710
DriI GACNNNNNGTC 1 cut(s) 422
Eam1104I CTCTTC 1 cut(s) 165
Eam1105I GACNNNNNGTC 1 cut(s) 422
EarI CTCTTC 1 cut(s) 165
EciI GGCGGA 1 cut(s) 758
Eco147I AGGCCT 1 cut(s) 632
Eco31I GGTCTC 2 cut(s) 252, 500
Eco32I GATATC 1 cut(s) 727
Eco47I GGWCC 1 cut(s) 202
Eco57I CTGAAG 3 cut(s) 132, 182, 558
EcoO109I RGGNCCY 1 cut(s) 202
EcoRII CCWGG 1 cut(s) 678
EcoRV GATATC 1 cut(s) 727
FaeI CATG 5 cut(s) 61, 169, 280, 688, 791
FalI AAGNNNNNCTT 2 cut(s) 638, 670
FatI CATG 5 cut(s) 57, 165, 276, 684, 787
FbaI TGATCA 1 cut(s) 331
FokI GGATG 1 cut(s) 758
GsaI CCCAGC 2 cut(s) 366, 753
HaeIII GGCC 2 cut(s) 56, 632
HapII CCGG 1 cut(s) 522
Hin1II CATG 5 cut(s) 61, 169, 280, 688, 791
HindIII AAGCTT 1 cut(s) 652
HinfI GANTC 4 cut(s) 121, 264, 323, 423
HpaII CCGG 1 cut(s) 522
HphI GGTGA 2 cut(s) 616, 722
Hpy166II GTNNAC 3 cut(s) 225, 416, 713
Hpy188I TCNGA 2 cut(s) 291, 578
Hpy188III TCNNGA 5 cut(s) 191, 200, 499, 617, 888
Hpy8I GTNNAC 3 cut(s) 225, 416, 713
HpyAV CCTTC 5 cut(s) 142, 368, 498, 581, 631
HpyCH4III ACNGT 2 cut(s) 233, 494
HpyCH4IV ACGT 1 cut(s) 36
HpyCH4V TGCA 2 cut(s) 667, 791
HpyF10VI GCNNNNNNNGC 1 cut(s) 158
HpyF3I CTNAG 7 cut(s) 29, 245, 254, 290, 300, 419, 431
HpySE526I ACGT 1 cut(s) 36
Hsp92II CATG 5 cut(s) 61, 169, 280, 688, 791
Ksp22I TGATCA 1 cut(s) 331
Kzo9I GATC 5 cut(s) 7, 40, 193, 331, 388
LmnI GCTCC 1 cut(s) 481
LweI GCATC 2 cut(s) 676, 736
MaeII ACGT 1 cut(s) 36
MaeIII GTNAC 2 cut(s) 32, 406
MalI GATC 5 cut(s) 9, 42, 195, 333, 390
MboI GATC 5 cut(s) 7, 40, 193, 331, 388
MboII GAAGA 8 cut(s) 125, 152, 182, 188, 224, 551, 565, 776
MhlI GDGCHC 1 cut(s) 486
MluCI AATT 1 cut(s) 131
MlyI GAGTC 1 cut(s) 432
MmeI TCCRAC 1 cut(s) 809
MnlI CCTC 7 cut(s) 38, 285, 349, 390, 520, 565, 622
MroXI GAANNNNTTC 1 cut(s) 783
MseI TTAA 5 cut(s) 45, 309, 477, 644, 720
MslI CAYNNNNRTG 1 cut(s) 689
MspCI CTTAAG 1 cut(s) 44
MspI CCGG 1 cut(s) 522
MspR9I CCNGG 1 cut(s) 680
MvaI CCWGG 1 cut(s) 680
MwoI GCNNNNNNNGC 1 cut(s) 158
NdeII GATC 5 cut(s) 7, 40, 193, 331, 388
NlaIII CATG 5 cut(s) 61, 169, 280, 688, 791
NmuCI GTSAC 1 cut(s) 406
PceI AGGCCT 1 cut(s) 632
PdmI GAANNNNTTC 1 cut(s) 783
PfeI GAWTC 3 cut(s) 121, 264, 323
PflFI GACNNNGTC 1 cut(s) 19
PfoI TCCNGGA 1 cut(s) 678
PleI GAGTC 1 cut(s) 431
PpsI GAGTC 1 cut(s) 431
PpuMI RGGWCCY 1 cut(s) 202
PshBI ATTAAT 1 cut(s) 720
Psp5II RGGWCCY 1 cut(s) 202
Psp6I CCWGG 1 cut(s) 678
PspFI CCCAGC 2 cut(s) 362, 749
PspGI CCWGG 1 cut(s) 678
PspPI GGNCC 1 cut(s) 202
PspPPI RGGWCCY 1 cut(s) 202
PstNI CAGNNNCTG 2 cut(s) 80, 205
PsyI GACNNNGTC 1 cut(s) 19
RsaI GTAC 2 cut(s) 368, 509
RsaNI GTAC 2 cut(s) 367, 508
RseI CAYNNNNRTG 1 cut(s) 689
SaqAI TTAA 5 cut(s) 45, 309, 477, 644, 720
Sau3AI GATC 5 cut(s) 7, 40, 193, 331, 388
Sau96I GGNCC 1 cut(s) 202
SchI GAGTC 1 cut(s) 432
ScrFI CCNGG 1 cut(s) 680
SduI GDGCHC 1 cut(s) 486
SfaNI GCATC 2 cut(s) 676, 736
SinI GGWCC 1 cut(s) 202
SmiMI CAYNNNNRTG 1 cut(s) 689
SmlI CTYRAG 3 cut(s) 44, 101, 497
SmoI CTYRAG 3 cut(s) 44, 101, 497
Sse9I AATT 1 cut(s) 131
SseBI AGGCCT 1 cut(s) 632
SsiI CCGC 2 cut(s) 689, 743
SspI AATATT 1 cut(s) 343
StuI AGGCCT 1 cut(s) 632
StyD4I CCNGG 1 cut(s) 678
TaaI ACNGT 2 cut(s) 233, 494
TaiI ACGT 1 cut(s) 39
TaqI TCGA 2 cut(s) 391, 729
TaqII GACCGA 1 cut(s) 276
TasI AATT 1 cut(s) 131
TfiI GAWTC 3 cut(s) 121, 264, 323
Tru1I TTAA 5 cut(s) 45, 309, 477, 644, 720
Tru9I TTAA 5 cut(s) 45, 309, 477, 644, 720
TscAI CASTG 1 cut(s) 238
TseFI GTSAC 1 cut(s) 406
Tsp45I GTSAC 1 cut(s) 406
TspDTI ATGAA 5 cut(s) 17, 74, 225, 458, 776
TspRI CASTG 1 cut(s) 238
Tth111I GACNNNGTC 1 cut(s) 19
Vha464I CTTAAG 1 cut(s) 44
VpaK11BI GGWCC 1 cut(s) 202
VspI ATTAAT 1 cut(s) 720
XapI RAATTY 1 cut(s) 131
XmnI GAANNNNTTC 1 cut(s) 783
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.