Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003301.1

Orthogroup ID

OG0013752

Physical Location & Seq

Genomic Coordinates Forward (+)

53777 .. 54133

Gene Structure 357 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003301.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 357 bp

atgacgaccgccacgggtcctccgccgcctccgccaccgcctccactctctgcagaccccgctgactccgaaaccctagacaatgtgccgatggagaccacctcccattcttcaacccaaataaagcctccgatggggcctccacctcccaaaaaccctagtccacctcctcctcctccccaaaacccaaaccccactccaccctctacatccaccaccgactccgagacctccaagcaccaatcccaaggctttgccgtcccttattcgattcctgaatggagtggagctccatgccaccagttccagctcgaggtcctcaaggacagcgccattgtcgaccaattcaatgtgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

FHA

Protein Analysis

118

Amino Acids

12.42

Weight (kDa)

4.49

Isoelectric Point (pI)

60.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013752)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0363721 RchiOBHm_Chr2g0173981 RchiOBHm_Chr4g0394391
rosa_multiflora	Rmu_sc0001644.1_g000025 Rmu_sc0003301.1_g000014 Rmu_sc0005592.1_g000022 Rmu_sc0009451.1_g000005 Rmu_sc0033532.1_g000001
rosa_roxburghii	Rroxscaffold_160G00433970 Rroxscaffold_1G00043050 Rroxscaffold_4G00311030 Rroxscaffold_5G00368050 Rroxscaffold_6G00395850 Rroxscaffold_6G00404020 Rroxscaffold_7G00182210
rosa_rugosa	Rorug05G0195200
rosa_samantha	Rh4DG298400
rosa_wichuraiana	Rw4G008430

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	339
AciI	CCGC	6 cut(s)	9, 23, 26, 32, 38, 60
AfiI	CCNNNNNNNGG	2 cut(s)	134, 313
AgsI	TTSAA	2 cut(s)	114, 349
AluBI	AGCT	2 cut(s)	290, 310
AluI	AGCT	2 cut(s)	290, 310
Alw21I	GWGCWC	1 cut(s)	292
Alw26I	GTCTC	2 cut(s)	89, 221
Ama87I	CYCGRG	1 cut(s)	311
AoxI	GGCC	1 cut(s)	137
AspLEI	GCGC	1 cut(s)	332
AspS9I	GGNCC	3 cut(s)	17, 137, 316
AvaI	CYCGRG	1 cut(s)	311
AvaII	GGWCC	2 cut(s)	17, 316
BanII	GRGCYC	1 cut(s)	292
Bbv12I	GWGCWC	1 cut(s)	292
BccI	CCATC	2 cut(s)	85, 127
BceAI	ACGGC	1 cut(s)	242
BcoDI	GTCTC	2 cut(s)	89, 221
BfaI	CTAG	2 cut(s)	77, 159
BfmI	CTRYAG	1 cut(s)	51
BfoI	RGCGCY	1 cut(s)	333
BisI	GCNGC	1 cut(s)	26
BlsI	GCNGC	1 cut(s)	27
Bme18I	GGWCC	2 cut(s)	17, 316
BmeT110I	CYCGRG	1 cut(s)	311
BmgT120I	GGNCC	3 cut(s)	17, 137, 316
BmiI	GGNNCC	2 cut(s)	18, 138
BplI	GAGNNNNNCTC	4 cut(s)	86, 118, 274, 306
BpuEI	CTTGAG	1 cut(s)	305
BsaI	GGTCTC	2 cut(s)	89, 221
BsaJI	CCNNGG	2 cut(s)	12, 247
BsaXI	ACNNNNNCTCC	1 cut(s)	34
Bsc4I	CCNNNNNNNGG	2 cut(s)	134, 313
Bse1I	ACTGG	1 cut(s)	301
BseDI	CCNNGG	2 cut(s)	12, 247
BseGI	GGATG	1 cut(s)	209
BseLI	CCNNNNNNNGG	2 cut(s)	134, 313
BseNI	ACTGG	1 cut(s)	301
BseRI	GAGGAG	3 cut(s)	159, 162, 165
Bsh1285I	CGRYCG	1 cut(s)	9
BshFI	GGCC	1 cut(s)	139
BsiEI	CGRYCG	1 cut(s)	9
BsiHKAI	GWGCWC	1 cut(s)	292
BsiHKCI	CYCGRG	1 cut(s)	311
BslFI	GGGAC	1 cut(s)	245
BslI	CCNNNNNNNGG	2 cut(s)	134, 313
BsmAI	GTCTC	2 cut(s)	89, 221
BsmFI	GGGAC	1 cut(s)	245
BsnI	GGCC	1 cut(s)	139
Bso31I	GGTCTC	2 cut(s)	89, 221
BsoBI	CYCGRG	1 cut(s)	311
Bsp1286I	GDGCHC	1 cut(s)	292
BspACI	CCGC	6 cut(s)	9, 23, 26, 32, 38, 60
BspANI	GGCC	1 cut(s)	139
BspLI	GGNNCC	2 cut(s)	18, 138
BspMAI	CTGCAG	1 cut(s)	55
BspTNI	GGTCTC	2 cut(s)	89, 221
BsrI	ACTGG	1 cut(s)	301
BssECI	CCNNGG	2 cut(s)	12, 247
BssT1I	CCWWGG	1 cut(s)	247
BstDSI	CCRYGG	1 cut(s)	12
BstF5I	GGATG	1 cut(s)	209
BstH2I	RGCGCY	1 cut(s)	333
BstHHI	GCGC	1 cut(s)	332
BstMAI	GTCTC	2 cut(s)	89, 221
BstMCI	CGRYCG	1 cut(s)	9
BstMWI	GCNNNNNNNGC	2 cut(s)	31, 59
BstSFI	CTRYAG	1 cut(s)	51
BsuRI	GGCC	1 cut(s)	139
BtgI	CCRYGG	1 cut(s)	12
BtsCI	GGATG	1 cut(s)	209
CfoI	GCGC	1 cut(s)	332
Cfr13I	GGNCC	3 cut(s)	17, 137, 316
CviAII	CATG	1 cut(s)	294
CviJI	RGCY	5 cut(s)	127, 139, 252, 290, 310
CviKI_1	RGCY	5 cut(s)	127, 139, 252, 290, 310
EciI	GGCGGA	2 cut(s)	12, 21
Ecl136II	GAGCTC	1 cut(s)	290
Eco130I	CCWWGG	1 cut(s)	247
Eco24I	GRGCYC	1 cut(s)	292
Eco31I	GGTCTC	2 cut(s)	89, 221
Eco47I	GGWCC	2 cut(s)	17, 316
Eco53kI	GAGCTC	1 cut(s)	290
Eco88I	CYCGRG	1 cut(s)	311
EcoICRI	GAGCTC	1 cut(s)	290
EcoO109I	RGGNCCY	3 cut(s)	17, 137, 316
EcoT14I	CCWWGG	1 cut(s)	247
EcoT38I	GRGCYC	1 cut(s)	292
ErhI	CCWWGG	1 cut(s)	247
FaeI	CATG	1 cut(s)	297
FaiI	YATR	1 cut(s)	295
FaqI	GGGAC	1 cut(s)	245
FatI	CATG	1 cut(s)	293
FauI	CCCGC	1 cut(s)	67
FblI	GTMKAC	1 cut(s)	339
Fnu4HI	GCNGC	1 cut(s)	26
FokI	GGATG	1 cut(s)	196
FriOI	GRGCYC	1 cut(s)	292
Fsp4HI	GCNGC	1 cut(s)	26
FspBI	CTAG	2 cut(s)	77, 159
GlaI	GCGC	1 cut(s)	331
GluI	GCNGC	1 cut(s)	26
HaeII	RGCGCY	1 cut(s)	333
HaeIII	GGCC	1 cut(s)	139
HhaI	GCGC	1 cut(s)	332
Hin1II	CATG	1 cut(s)	297
Hin6I	GCGC	1 cut(s)	330
HinP1I	GCGC	1 cut(s)	330
HincII	GTYRAC	1 cut(s)	340
HindII	GTYRAC	1 cut(s)	340
HinfI	GANTC	3 cut(s)	65, 221, 271
Hpy166II	GTNNAC	2 cut(s)	164, 340
Hpy188I	TCNGA	3 cut(s)	70, 132, 226
Hpy188III	TCNNGA	1 cut(s)	275
Hpy8I	GTNNAC	2 cut(s)	164, 340
HpyCH4V	TGCA	1 cut(s)	53
HpyF10VI	GCNNNNNNNGC	2 cut(s)	31, 59
Hsp92II	CATG	1 cut(s)	297
HspAI	GCGC	1 cut(s)	330
LmnI	GCTCC	2 cut(s)	287, 295
LpnPI	CCDG	3 cut(s)	288, 314, 320
MaeI	CTAG	2 cut(s)	77, 159
MboII	GAAGA	1 cut(s)	102
MhlI	GDGCHC	1 cut(s)	292
MluCI	AATT	1 cut(s)	344
MlyI	GAGTC	2 cut(s)	59, 215
MspA1I	CMGCKG	1 cut(s)	62
MwoI	GCNNNNNNNGC	2 cut(s)	31, 59
NlaIII	CATG	1 cut(s)	297
NlaIV	GGNNCC	2 cut(s)	18, 138
PaeR7I	CTCGAG	1 cut(s)	311
PfeI	GAWTC	1 cut(s)	271
PkrI	GCNGC	1 cut(s)	27
PleI	GAGTC	2 cut(s)	59, 215
PpsI	GAGTC	2 cut(s)	59, 215
PpuMI	RGGWCCY	2 cut(s)	17, 316
Psp124BI	GAGCTC	1 cut(s)	292
Psp5II	RGGWCCY	2 cut(s)	17, 316
PspN4I	GGNNCC	2 cut(s)	18, 138
PspPI	GGNCC	3 cut(s)	17, 137, 316
PspPPI	RGGWCCY	2 cut(s)	17, 316
PspXI	VCTCGAGB	1 cut(s)	311
PstI	CTGCAG	1 cut(s)	55
SacI	GAGCTC	1 cut(s)	292
SalI	GTCGAC	1 cut(s)	338
SatI	GCNGC	1 cut(s)	26
Sau96I	GGNCC	3 cut(s)	17, 137, 316
SchI	GAGTC	2 cut(s)	59, 215
SduI	GDGCHC	1 cut(s)	292
SetI	ASST	7 cut(s)	104, 148, 169, 233, 292, 312, 318
SfcI	CTRYAG	1 cut(s)	51
Sfr274I	CTCGAG	1 cut(s)	311
SinI	GGWCC	2 cut(s)	17, 316
SlaI	CTCGAG	1 cut(s)	311
SmlI	CTYRAG	2 cut(s)	311, 320
SmoI	CTYRAG	2 cut(s)	311, 320
Sse9I	AATT	1 cut(s)	344
SsiI	CCGC	6 cut(s)	9, 23, 26, 32, 38, 60
SspMI	CTAG	2 cut(s)	77, 159
SstI	GAGCTC	1 cut(s)	292
StyI	CCWWGG	1 cut(s)	247
TaqI	TCGA	3 cut(s)	269, 312, 339
TasI	AATT	1 cut(s)	344
TauI	GCSGC	1 cut(s)	28
TfiI	GAWTC	1 cut(s)	271
VpaK11BI	GGWCC	2 cut(s)	17, 316
XhoI	CTCGAG	1 cut(s)	311
XmiI	GTMKAC	1 cut(s)	339
XspI	CTAG	2 cut(s)	77, 159

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.