Rmu_sc0003574.1_g000004

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003574.1
Physical Location & Seq
Forward (+)
26774 .. 27201
428 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003574.1_g000004.1.cds

Sequence Viewer

Length: 339 bp
atgacaggggcaaaagtgccagattatcatcagtatattacatctttgaatactcatgacattaatggcggcaagatacagtgcctaaataattgttcttgcctggcttatgcactcattaataacattgggtgtttggtctggtccaaagaccttctagatatatcggagttctcccagggaggtgttgatctttataatcgcctagcacgcaaagaactaggtgaaggaaagccaattaagttgattgtcatccttacagctattggtttaacgattatcttggttgccatactgatcggtttgcacaaattgcgagctaaccaaatgggtaagtga

Protein Analysis

112

Amino Acids

12.24

Weight (kDa)

8.73

Isoelectric Point (pI)

25.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 198
AciI CCGC 1 cut(s) 69
AgsI TTSAA 1 cut(s) 49
AjnI CCWGG 2 cut(s) 102, 177
AluBI AGCT 2 cut(s) 263, 320
AluI AGCT 2 cut(s) 263, 320
AseI ATTAAT 2 cut(s) 63, 120
AspS9I GGNCC 1 cut(s) 144
AsuHPI GGTGA 1 cut(s) 236
AvaII GGWCC 1 cut(s) 144
BciT130I CCWGG 2 cut(s) 104, 179
BfaI CTAG 3 cut(s) 158, 206, 221
BisI GCNGC 1 cut(s) 70
BlsI GCNGC 1 cut(s) 71
Bme1390I CCNGG 2 cut(s) 104, 179
Bme18I GGWCC 1 cut(s) 144
BmgT120I GGNCC 1 cut(s) 144
BmrFI CCNGG 2 cut(s) 104, 179
BsaBI GATNNNNATC 2 cut(s) 27, 251
BsaJI CCNNGG 2 cut(s) 177, 178
Bse8I GATNNNNATC 2 cut(s) 27, 251
BseBI CCWGG 2 cut(s) 104, 179
BseDI CCNNGG 2 cut(s) 177, 178
BseGI GGATG 1 cut(s) 252
BseJI GATNNNNATC 2 cut(s) 27, 251
Bsp143I GATC 2 cut(s) 190, 297
BspACI CCGC 1 cut(s) 69
BspHI TCATGA 1 cut(s) 55
BssECI CCNNGG 2 cut(s) 177, 178
BssMI GATC 2 cut(s) 190, 297
Bst2UI CCWGG 2 cut(s) 104, 179
Bst4CI ACNGT 1 cut(s) 81
BstAPI GCANNNNNTGC 1 cut(s) 313
BstC8I GCNNGC 2 cut(s) 211, 318
BstF5I GGATG 1 cut(s) 252
BstKTI GATC 2 cut(s) 193, 300
BstMBI GATC 2 cut(s) 190, 297
BstMWI GCNNNNNNNGC 2 cut(s) 210, 313
BstNI CCWGG 2 cut(s) 104, 179
BstSCI CCNGG 2 cut(s) 102, 177
BtsCI GGATG 1 cut(s) 252
BtsIMutI CAGTG 1 cut(s) 86
Cac8I GCNNGC 2 cut(s) 211, 318
CciI TCATGA 1 cut(s) 55
Cfr13I GGNCC 1 cut(s) 144
CviAII CATG 1 cut(s) 56
CviJI RGCY 4 cut(s) 107, 235, 263, 320
CviKI_1 RGCY 4 cut(s) 107, 235, 263, 320
DpnI GATC 2 cut(s) 192, 299
DpnII GATC 2 cut(s) 190, 297
Eco47I GGWCC 1 cut(s) 144
EcoRII CCWGG 2 cut(s) 102, 177
FaeI CATG 1 cut(s) 59
FaiI YATR 6 cut(s) 36, 57, 111, 164, 198, 293
FatI CATG 1 cut(s) 55
Fnu4HI GCNGC 1 cut(s) 70
FokI GGATG 1 cut(s) 239
Fsp4HI GCNGC 1 cut(s) 70
FspBI CTAG 3 cut(s) 158, 206, 221
GluI GCNGC 1 cut(s) 70
Hin1II CATG 1 cut(s) 59
HphI GGTGA 1 cut(s) 236
Hpy188I TCNGA 1 cut(s) 169
Hpy188III TCNNGA 2 cut(s) 56, 158
HpyAV CCTTC 2 cut(s) 164, 221
HpyCH4III ACNGT 1 cut(s) 81
HpyCH4V TGCA 2 cut(s) 113, 307
HpyF10VI GCNNNNNNNGC 2 cut(s) 210, 313
Hsp92II CATG 1 cut(s) 59
Kzo9I GATC 2 cut(s) 190, 297
LpnPI CCDG 6 cut(s) 33, 89, 116, 127, 164, 191
MaeI CTAG 3 cut(s) 158, 206, 221
MalI GATC 2 cut(s) 192, 299
MboI GATC 2 cut(s) 190, 297
MluCI AATT 3 cut(s) 91, 237, 311
MnlI CCTC 1 cut(s) 176
MseI TTAA 4 cut(s) 63, 120, 240, 272
MspR9I CCNGG 2 cut(s) 104, 179
MvaI CCWGG 2 cut(s) 104, 179
MwoI GCNNNNNNNGC 2 cut(s) 210, 313
NdeII GATC 2 cut(s) 190, 297
NlaIII CATG 1 cut(s) 59
PagI TCATGA 1 cut(s) 55
PasI CCCWGGG 1 cut(s) 178
PkrI GCNGC 1 cut(s) 71
PshBI ATTAAT 2 cut(s) 63, 120
PsiI TTATAA 1 cut(s) 198
Psp6I CCWGG 2 cut(s) 102, 177
PspGI CCWGG 2 cut(s) 102, 177
PspPI GGNCC 1 cut(s) 144
SaqAI TTAA 4 cut(s) 63, 120, 240, 272
SatI GCNGC 1 cut(s) 70
Sau3AI GATC 2 cut(s) 190, 297
Sau96I GGNCC 1 cut(s) 144
ScrFI CCNGG 2 cut(s) 104, 179
SetI ASST 5 cut(s) 156, 187, 226, 265, 322
SinI GGWCC 1 cut(s) 144
Sse9I AATT 3 cut(s) 91, 237, 311
SsiI CCGC 1 cut(s) 69
SspMI CTAG 3 cut(s) 158, 206, 221
StyD4I CCNGG 2 cut(s) 102, 177
TaaI ACNGT 1 cut(s) 81
TasI AATT 3 cut(s) 91, 237, 311
TauI GCSGC 1 cut(s) 72
Tru1I TTAA 4 cut(s) 63, 120, 240, 272
Tru9I TTAA 4 cut(s) 63, 120, 240, 272
TscAI CASTG 1 cut(s) 86
TspRI CASTG 1 cut(s) 86
VpaK11BI GGWCC 1 cut(s) 144
VspI ATTAAT 2 cut(s) 63, 120
XbaI TCTAGA 1 cut(s) 157
XspI CTAG 3 cut(s) 158, 206, 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.