Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr5C

Orthogroup ID

OG0014817

Physical Location & Seq

Genomic Coordinates Reverse (-)

3474294 .. 3475334

Gene Structure 1041 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh5CG049000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 636 bp

ATGGATGATCGATATCAGAGTGGATTTAGTCTAGATGATAATGTGATACAGGGAACAAAGTATTTCTCTTATAATTTGTTTGACAGTGGTATCTCATATTTAGCCATTTCCTCAGAAGGGATATCAAACCTTATGCTTTCAGATAGTGGCAATTGGTCTCTTAACTGGGAGGCACCAAGTAATCCATGTGACTACTATGGAACATGTGGACCTTTTGGTGTTTGCAAGGCTTCTGAATCTACAATCTGCAAGTGTTTGAAAGGGTTTATGCCAAAGTCAAATGAGGAATGGAGCAAAGGAAACTGGACAGGAGGGTGTGTAAGGCGAACCAATTTGTTTTGTGAGACTAACACTAGCAATGATGGGTTTTGGAAGATGGTGAGGTTGAAAGTACCAGATTCTCATGAATTTGTTGTTACATCTTTGGATGATGAAAACTCGGCTGACGACTGCAAGATACGGTGCCTAAAGAATTGTTCTTGCCTGGCTTATGCATTTGTTAATAACATAGGTTGTTTGGTCTGGTCCAAAGACCTTCTTGATGTTCAGGAGTTTTCCTCTGGCGGAGTAGATCTTTATATTCGCCTCGCACACTCAGAACTAGGTAATGATATATTATTTCTTGCACAACTCTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04010 ko04064 ko04620 ko04621 ko04624 ko04722 ko05133 ko05140 ko05142 ko05145 ko05152 ko05162 ko05164 map04010 map04064 map04620 map04621 map04624 map04722 map05133 map05140 map05142 map05145 map05152 map05162 map05164

Pfam Domains

Protein Families

B_lectin DUF3403 PAN_2 Pkinase Pkinase_Tyr S_locus_glycop

Protein Analysis

211

Amino Acids

23.52

Weight (kDa)

4.59

Isoelectric Point (pI)

30.12

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
S_locus_glycop	PF00954	5 - 93	9e-21	S-locus glycoprotein domain
PAN_2	PF08276	114 - 182	1e-16	PAN-like domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014817)

Species	Orthologous Gene IDs
malus_domestica	MD05G1331800.v1.1
rosa_chinensis	RchiOBHm_Chr1g0319261 RchiOBHm_Chr3g0485181 RchiOBHm_Chr5g0005271
rosa_multiflora	Rmu_co8365119.1_g000001 Rmu_sc0003574.1_g000004 Rmu_sc0005072.1_g000020
rosa_roxburghii	Rroxscaffold_7G00196510
rosa_rugosa	Rorug01G0087200 Rorug03G0199900 Rorug06G0067000
rosa_samantha	Rh1BG035300 Rh1BG035600 Rh5CG049000 Rh5CG049700 Rh5CG051700 Rh5CG051900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	72
AccB1I	GGYRCC	2 cut(s)	172, 462
AciI	CCGC	1 cut(s)	564
AcsI	RAATTY	1 cut(s)	407
AfaI	GTAC	1 cut(s)	393
AfiI	CCNNNNNNNGG	1 cut(s)	117
AflIII	ACRYGT	1 cut(s)	203
AgsI	TTSAA	2 cut(s)	259, 388
AjnI	CCWGG	1 cut(s)	483
Alw26I	GTCTC	2 cut(s)	162, 338
ApoI	RAATTY	1 cut(s)	407
AspS9I	GGNCC	2 cut(s)	209, 525
AsuHPI	GGTGA	1 cut(s)	391
AvaII	GGWCC	2 cut(s)	209, 525
BaeI	ACNNNNGTAYC	2 cut(s)	73, 106
BanI	GGYRCC	2 cut(s)	172, 462
BccI	CCATC	2 cut(s)	356, 370
BciT130I	CCWGG	1 cut(s)	485
BcoDI	GTCTC	2 cut(s)	162, 338
BfaI	CTAG	3 cut(s)	32, 354, 602
BglII	AGATCT	1 cut(s)	571
Bme1390I	CCNGG	1 cut(s)	485
Bme18I	GGWCC	2 cut(s)	209, 525
BmgT120I	GGNCC	2 cut(s)	209, 525
BmiI	GGNNCC	2 cut(s)	174, 464
BmrFI	CCNGG	1 cut(s)	485
BmrI	ACTGGG	1 cut(s)	175
BmuI	ACTGGG	1 cut(s)	175
BplI	GAGNNNNNCTC	2 cut(s)	542, 574
Bsa29I	ATCGAT	1 cut(s)	10
BsaBI	GATNNNNATC	1 cut(s)	12
BsaI	GGTCTC	1 cut(s)	162
BsaXI	ACNNNNNCTCC	2 cut(s)	303, 333
Bsc4I	CCNNNNNNNGG	1 cut(s)	117
Bse1I	ACTGG	2 cut(s)	170, 308
Bse3DI	GCAATG	1 cut(s)	364
Bse8I	GATNNNNATC	1 cut(s)	12
BseBI	CCWGG	1 cut(s)	485
BseCI	ATCGAT	1 cut(s)	10
BseGI	GGATG	2 cut(s)	10, 433
BseJI	GATNNNNATC	1 cut(s)	12
BseLI	CCNNNNNNNGG	1 cut(s)	117
BseMI	GCAATG	1 cut(s)	364
BseMII	CTCAG	2 cut(s)	126, 609
BseNI	ACTGG	2 cut(s)	170, 308
BshNI	GGYRCC	2 cut(s)	172, 462
BshVI	ATCGAT	1 cut(s)	10
BslI	CCNNNNNNNGG	1 cut(s)	117
BsmAI	GTCTC	2 cut(s)	162, 338
Bso31I	GGTCTC	1 cut(s)	162
Bsp143I	GATC	2 cut(s)	7, 571
BspACI	CCGC	1 cut(s)	564
BspCNI	CTCAG	2 cut(s)	125, 608
BspDI	ATCGAT	1 cut(s)	10
BspHI	TCATGA	1 cut(s)	403
BspLI	GGNNCC	2 cut(s)	174, 464
BspT107I	GGYRCC	2 cut(s)	172, 462
BspTNI	GGTCTC	1 cut(s)	162
BsrDI	GCAATG	1 cut(s)	364
BsrI	ACTGG	2 cut(s)	170, 308
BssMI	GATC	2 cut(s)	7, 571
Bst2UI	CCWGG	1 cut(s)	485
Bst4CI	ACNGT	2 cut(s)	86, 462
BstDEI	CTNAG	2 cut(s)	112, 595
BstF5I	GGATG	2 cut(s)	10, 433
BstKTI	GATC	2 cut(s)	10, 574
BstMAI	GTCTC	2 cut(s)	162, 338
BstMBI	GATC	2 cut(s)	7, 571
BstNI	CCWGG	1 cut(s)	485
BstNSI	RCATGY	1 cut(s)	207
BstSCI	CCNGG	1 cut(s)	483
BstX2I	RGATCY	1 cut(s)	571
BstYI	RGATCY	1 cut(s)	571
Bsu15I	ATCGAT	1 cut(s)	10
BsuTUI	ATCGAT	1 cut(s)	10
BtsCI	GGATG	2 cut(s)	10, 433
BtsIMutI	CAGTG	1 cut(s)	91
CciI	TCATGA	1 cut(s)	403
Cfr13I	GGNCC	2 cut(s)	209, 525
ClaI	ATCGAT	1 cut(s)	10
Csp6I	GTAC	1 cut(s)	392
CviAII	CATG	3 cut(s)	186, 204, 404
CviJI	RGCY	4 cut(s)	104, 230, 443, 488
CviKI_1	RGCY	4 cut(s)	104, 230, 443, 488
CviQI	GTAC	1 cut(s)	392
DdeI	CTNAG	2 cut(s)	112, 595
DpnI	GATC	2 cut(s)	9, 573
DpnII	GATC	2 cut(s)	7, 571
EciI	GGCGGA	1 cut(s)	579
Eco31I	GGTCTC	1 cut(s)	162
Eco32I	GATATC	2 cut(s)	14, 123
Eco47I	GGWCC	2 cut(s)	209, 525
EcoRII	CCWGG	1 cut(s)	483
EcoRV	GATATC	2 cut(s)	14, 123
EcoT22I	ATGCAT	1 cut(s)	496
FaeI	CATG	3 cut(s)	189, 207, 407
FalI	AAGNNNNNCTT	2 cut(s)	522, 554
FatI	CATG	3 cut(s)	185, 203, 403
FokI	GGATG	2 cut(s)	17, 440
FspBI	CTAG	3 cut(s)	32, 354, 602
Hin1II	CATG	3 cut(s)	189, 207, 407
HinfI	GANTC	2 cut(s)	236, 398
HphI	GGTGA	1 cut(s)	391
Hpy166II	GTNNAC	1 cut(s)	209
Hpy188I	TCNGA	6 cut(s)	18, 115, 142, 235, 598, 635
Hpy188III	TCNNGA	4 cut(s)	32, 404, 539, 548
Hpy8I	GTNNAC	1 cut(s)	209
HpyAV	CCTTC	2 cut(s)	110, 545
HpyCH4III	ACNGT	2 cut(s)	86, 462
HpyCH4V	TGCA	5 cut(s)	225, 249, 453, 494, 626
HpyF3I	CTNAG	2 cut(s)	112, 595
Hsp92II	CATG	3 cut(s)	189, 207, 407
Kzo9I	GATC	2 cut(s)	7, 571
LmnI	GCTCC	1 cut(s)	291
MaeI	CTAG	3 cut(s)	32, 354, 602
MaeIII	GTNAC	2 cut(s)	188, 415
MalI	GATC	2 cut(s)	9, 573
MboI	GATC	2 cut(s)	7, 571
MboII	GAAGA	1 cut(s)	385
MfeI	CAATTG	1 cut(s)	151
MflI	RGATCY	1 cut(s)	571
MluCI	AATT	5 cut(s)	73, 151, 331, 407, 472
MnlI	CCTC	7 cut(s)	121, 163, 277, 305, 375, 568, 596
Mph1103I	ATGCAT	1 cut(s)	496
MseI	TTAA	2 cut(s)	162, 501
MspR9I	CCNGG	1 cut(s)	485
MunI	CAATTG	1 cut(s)	151
MvaI	CCWGG	1 cut(s)	485
NdeII	GATC	2 cut(s)	7, 571
NlaIII	CATG	3 cut(s)	189, 207, 407
NlaIV	GGNNCC	2 cut(s)	174, 464
NmeAIII	GCCGAG	1 cut(s)	419
NmuCI	GTSAC	1 cut(s)	188
NsiI	ATGCAT	1 cut(s)	496
NspI	RCATGY	1 cut(s)	207
PagI	TCATGA	1 cut(s)	403
PciI	ACATGT	1 cut(s)	203
PfeI	GAWTC	2 cut(s)	236, 398
PscI	ACATGT	1 cut(s)	203
PsiI	TTATAA	1 cut(s)	72
Psp6I	CCWGG	1 cut(s)	483
PspGI	CCWGG	1 cut(s)	483
PspN4I	GGNNCC	2 cut(s)	174, 464
PspPI	GGNCC	2 cut(s)	209, 525
PsuI	RGATCY	1 cut(s)	571
RsaI	GTAC	1 cut(s)	393
RsaNI	GTAC	1 cut(s)	392
SaqAI	TTAA	2 cut(s)	162, 501
Sau3AI	GATC	2 cut(s)	7, 571
Sau96I	GGNCC	2 cut(s)	209, 525
ScrFI	CCNGG	1 cut(s)	485
SetI	ASST	6 cut(s)	132, 214, 386, 514, 537, 607
SinI	GGWCC	2 cut(s)	209, 525
Sse9I	AATT	5 cut(s)	73, 151, 331, 407, 472
SsiI	CCGC	1 cut(s)	564
SspMI	CTAG	3 cut(s)	32, 354, 602
StyD4I	CCNGG	1 cut(s)	483
TaaI	ACNGT	2 cut(s)	86, 462
TaqI	TCGA	1 cut(s)	10
TasI	AATT	5 cut(s)	73, 151, 331, 407, 472
TfiI	GAWTC	2 cut(s)	236, 398
Tru1I	TTAA	2 cut(s)	162, 501
Tru9I	TTAA	2 cut(s)	162, 501
TscAI	CASTG	1 cut(s)	91
TseFI	GTSAC	1 cut(s)	188
Tsp45I	GTSAC	1 cut(s)	188
TspDTI	ATGAA	2 cut(s)	420, 447
TspRI	CASTG	1 cut(s)	91
VpaK11BI	GGWCC	2 cut(s)	209, 525
XapI	RAATTY	1 cut(s)	407
XbaI	TCTAGA	1 cut(s)	31
XceI	RCATGY	1 cut(s)	207
XspI	CTAG	3 cut(s)	32, 354, 602
Zsp2I	ATGCAT	1 cut(s)	496

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.