Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004036.1

Orthogroup ID

OG0005005

Physical Location & Seq

Genomic Coordinates Reverse (-)

8284 .. 9111

Gene Structure 828 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004036.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 828 bp

atgaagaatcggagcaatctgaagggattgttggctgccattttggtcttcttcctcggcgccgcgctttttatctccagctttaccggaaccggaacccccttcctctgctctctgcctaaatttgttgacgattatacccccacagcggttcagctccaggcggtgctccactacgctacgtcccatacgaccccgcagcaatcgagaggcgagatcggcgtctccttcgaggtcctcaaatcgcgggcgccgtgcaacttcctcgtattcggtctaggccacgactcgctcatgtgggcctcgtttaacccacgcggcacgacgctgttccttgaggaggaccccaagtgggtccagaccatcctgaaggacgcgccggagttgcgggccgagaccgtgaactaccgcacgcagttgaagcaggcggacgagctgctctcctcgtacaaatccgaaccggcgtgcgtgcagtccggggcggtcctacgtggcaacgagcggtgcaagctggcgctgagcaacctgccggacgaggtgtacgacaaggagtgggacctgatcatgatcgacgcgccgcggggttattttcccgaggcgcctggtcggatggcggctatattctcggcggctgtcatggccaggaggaggcggggatcaggtgccacgcacgtgttcttgcacgacgtagaccggaaggtggagaaggcttttgccgaggagtttctttgccggaagtaccttgttaaggccgtcgggaggctctggcattttgagattccttcagccgctaacgccaccgacaccgctggcgtgcgtttttgctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005794 GO:0005802 GO:0012505 GO:0031410 GO:0031982 GO:0031984 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044431 GO:0044444 GO:0044446 GO:0044464 GO:0097708 GO:0098791

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Polysacc_synt_4

Protein Analysis

275

Amino Acids

30.59

Weight (kDa)

8.49

Isoelectric Point (pI)

36.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005005)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G27930 AT1G67330
fragaria_vesca	FvH4_3g25190 FvH4_4g23680 FvH4_4g23700
malus_domestica	MD13G1119900.v1.1 MD13G1120100.v1.1 MD16G1120000.v1.1
prunus_persica	Prupe.1G225200_v2.0.a1
pyrus_communis	pycom13g10440 pycom16g10250
rosa_chinensis	RchiOBHm_Chr4g0430171 RchiOBHm_Chr5g0046131
rosa_laevigata	RLG00000006999
rosa_multiflora	Rmu_sc0001035.1_g000058 Rmu_sc0004036.1_g000003 Rmu_sc0006003.1_g000015
rosa_roxburghii	Rroxscaffold_1G00035410 Rroxscaffold_5G00371970
rosa_rugosa	Rorug04G0241000 Rorug05G0225300
rosa_samantha	Rh4BG304200 Rh4CG319700 Rh4DG301700 Rh5AG306400 Rh5BG314600 Rh5CG341100 Rh5DG324900
rosa_wichuraiana	Rw4G025820 Rw5G028640

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	534
AccB1I	GGYRCC	4 cut(s)	59, 250, 598, 662
AccBSI	CCGCTC	1 cut(s)	502
AccI	GTMKAC	1 cut(s)	690
AccII	CGCG	6 cut(s)	65, 247, 318, 377, 575, 580
AclWI	GGATC	1 cut(s)	664
AcoI	YGGCCR	1 cut(s)	639
AcsI	RAATTY	1 cut(s)	122
AcuI	CTGAAG	3 cut(s)	41, 389, 768
AcvI	CACGTG	1 cut(s)	673
AcyI	GRCGYC	4 cut(s)	60, 222, 251, 599
AfaI	GTAC	3 cut(s)	449, 542, 740
AfiI	CCNNNNNNNGG	7 cut(s)	148, 340, 352, 648, 700, 748, 759
AflIII	ACRYGT	1 cut(s)	672
AgsI	TTSAA	1 cut(s)	421
AjnI	CCWGG	3 cut(s)	159, 601, 641
AjuI	GAANNNNNNNTTGG	2 cut(s)	14, 46
AleI	CACNNNNGTG	1 cut(s)	671
AluBI	AGCT	4 cut(s)	81, 157, 436, 511
AluI	AGCT	4 cut(s)	81, 157, 436, 511
Alw21I	GWGCWC	1 cut(s)	171
Alw26I	GTCTC	2 cut(s)	229, 389
AlwI	GGATC	1 cut(s)	664
Ama87I	CYCGRG	1 cut(s)	593
AoxI	GGCC	5 cut(s)	280, 300, 390, 639, 750
ApeKI	GCWGC	3 cut(s)	35, 199, 436
ApoI	RAATTY	1 cut(s)	122
AspLEI	GCGC	7 cut(s)	62, 67, 253, 379, 517, 577, 601
AspS9I	GGNCC	7 cut(s)	235, 300, 343, 355, 390, 484, 556
AsuC2I	CCSGG	1 cut(s)	478
AvaI	CYCGRG	1 cut(s)	593
AvaII	GGWCC	5 cut(s)	235, 343, 355, 484, 556
BalI	TGGCCA	1 cut(s)	641
BanI	GGYRCC	4 cut(s)	59, 250, 598, 662
BbrPI	CACGTG	1 cut(s)	673
BbsI	GAAGAC	1 cut(s)	40
Bbv12I	GWGCWC	1 cut(s)	171
BbvI	GCAGC	3 cut(s)	22, 211, 423
BccI	CCATC	2 cut(s)	371, 604
BceAI	ACGGC	2 cut(s)	238, 737
BcgI	CGANNNNNNTGC	2 cut(s)	247, 281
BciT130I	CCWGG	3 cut(s)	161, 603, 643
BclI	TGATCA	1 cut(s)	561
BcnI	CCSGG	1 cut(s)	478
BcoDI	GTCTC	2 cut(s)	229, 389
BfaI	CTAG	1 cut(s)	278
BfoI	RGCGCY	4 cut(s)	63, 254, 518, 602
BfuAI	ACCTGC	1 cut(s)	534
BisI	GCNGC	9 cut(s)	36, 63, 200, 319, 437, 578, 615, 630, 789
BlpI	GCTNAGC	1 cut(s)	518
BlsI	GCNGC	9 cut(s)	37, 64, 201, 320, 438, 579, 616, 631, 790
Bme1390I	CCNGG	4 cut(s)	161, 478, 603, 643
Bme18I	GGWCC	5 cut(s)	235, 343, 355, 484, 556
BmeT110I	CYCGRG	1 cut(s)	593
BmgT120I	GGNCC	7 cut(s)	235, 300, 343, 355, 390, 484, 556
BmiI	GGNNCC	9 cut(s)	61, 91, 97, 252, 345, 356, 557, 600, 664
BmrFI	CCNGG	4 cut(s)	161, 478, 603, 643
BpiI	GAAGAC	1 cut(s)	40
BplI	GAGNNNNNCTC	2 cut(s)	425, 457
BpmI	CTGGAG	2 cut(s)	61, 143
Bpu1102I	GCTNAGC	1 cut(s)	518
BpuEI	CTTGAG	1 cut(s)	356
BpuMI	CCSGG	1 cut(s)	478
BsaAI	YACGTR	2 cut(s)	491, 673
BsaBI	GATNNNNATC	1 cut(s)	566
BsaHI	GRCGYC	4 cut(s)	60, 222, 251, 599
BsaI	GGTCTC	1 cut(s)	389
BsaJI	CCNNGG	5 cut(s)	55, 477, 578, 594, 717
BsaWI	WCCGGW	3 cut(s)	86, 92, 693
Bsc4I	CCNNNNNNNGG	7 cut(s)	148, 340, 352, 648, 700, 748, 759
Bse118I	RCCGGY	1 cut(s)	460
Bse8I	GATNNNNATC	1 cut(s)	566
BseBI	CCWGG	3 cut(s)	161, 603, 643
BseDI	CCNNGG	5 cut(s)	55, 477, 578, 594, 717
BseGI	GGATG	2 cut(s)	363, 615
BseJI	GATNNNNATC	1 cut(s)	566
BseLI	CCNNNNNNNGG	7 cut(s)	148, 340, 352, 648, 700, 748, 759
BseMII	CTCAG	1 cut(s)	509
BseRI	GAGGAG	4 cut(s)	353, 433, 661, 734
BseXI	GCAGC	3 cut(s)	22, 211, 423
BsgI	GTGCAG	1 cut(s)	491
Bsh1236I	CGCG	6 cut(s)	65, 247, 318, 377, 575, 580
BshFI	GGCC	5 cut(s)	282, 302, 392, 641, 752
BshNI	GGYRCC	4 cut(s)	59, 250, 598, 662
BsiHKAI	GWGCWC	1 cut(s)	171
BsiHKCI	CYCGRG	1 cut(s)	593
BsiSI	CCGG	8 cut(s)	87, 93, 380, 461, 477, 530, 694, 733
BslFI	GGGAC	2 cut(s)	169, 569
BslI	CCNNNNNNNGG	7 cut(s)	148, 340, 352, 648, 700, 748, 759
BsmAI	GTCTC	2 cut(s)	229, 389
BsmBI	CGTCTC	1 cut(s)	229
BsmFI	GGGAC	2 cut(s)	169, 569
BsnI	GGCC	5 cut(s)	282, 302, 392, 641, 752
Bso31I	GGTCTC	1 cut(s)	389
BsoBI	CYCGRG	1 cut(s)	593
Bsp1286I	GDGCHC	1 cut(s)	171
Bsp143I	GATC	4 cut(s)	216, 561, 567, 656
Bsp1720I	GCTNAGC	1 cut(s)	518
BspANI	GGCC	5 cut(s)	282, 302, 392, 641, 752
BspCNI	CTCAG	1 cut(s)	510
BspFNI	CGCG	6 cut(s)	65, 247, 318, 377, 575, 580
BspHI	TCATGA	1 cut(s)	564
BspLI	GGNNCC	9 cut(s)	61, 91, 97, 252, 345, 356, 557, 600, 664
BspMI	ACCTGC	1 cut(s)	534
BspPI	GGATC	1 cut(s)	664
BspT107I	GGYRCC	4 cut(s)	59, 250, 598, 662
BspTNI	GGTCTC	1 cut(s)	389
BsrBI	CCGCTC	1 cut(s)	502
BsrFI	RCCGGY	1 cut(s)	460
BssAI	RCCGGY	1 cut(s)	460
BssECI	CCNNGG	5 cut(s)	55, 477, 578, 594, 717
BssMI	GATC	4 cut(s)	216, 561, 567, 656
BssNI	GRCGYC	4 cut(s)	60, 222, 251, 599
Bst2UI	CCWGG	3 cut(s)	161, 603, 643
Bst4CI	ACNGT	1 cut(s)	400
BstACI	GRCGYC	4 cut(s)	60, 222, 251, 599
BstBAI	YACGTR	2 cut(s)	491, 673
BstDEI	CTNAG	1 cut(s)	518
BstDSI	CCRYGG	1 cut(s)	578
BstENI	CCTNNNNNAGG	2 cut(s)	338, 746
BstF5I	GGATG	2 cut(s)	363, 615
BstFNI	CGCG	6 cut(s)	65, 247, 318, 377, 575, 580
BstH2I	RGCGCY	4 cut(s)	63, 254, 518, 602
BstHHI	GCGC	7 cut(s)	62, 67, 253, 379, 517, 577, 601
BstKTI	GATC	4 cut(s)	219, 564, 570, 659
BstMAI	GTCTC	2 cut(s)	229, 389
BstMBI	GATC	4 cut(s)	216, 561, 567, 656
BstMWI	GCNNNNNNNGC	6 cut(s)	219, 385, 421, 508, 638, 794
BstNI	CCWGG	3 cut(s)	161, 603, 643
BstSCI	CCNGG	4 cut(s)	159, 476, 601, 641
BstUI	CGCG	6 cut(s)	65, 247, 318, 377, 575, 580
BstV1I	GCAGC	3 cut(s)	22, 211, 423
BstV2I	GAAGAC	1 cut(s)	40
BsuRI	GGCC	5 cut(s)	282, 302, 392, 641, 752
BtgI	CCRYGG	1 cut(s)	578
BtsCI	GGATG	2 cut(s)	363, 615
BveI	ACCTGC	1 cut(s)	534
CciI	TCATGA	1 cut(s)	564
CfoI	GCGC	7 cut(s)	62, 67, 253, 379, 517, 577, 601
Cfr10I	RCCGGY	1 cut(s)	460
Cfr13I	GGNCC	7 cut(s)	235, 300, 343, 355, 390, 484, 556
Cfr42I	CCGCGG	1 cut(s)	581
CseI	GACGC	4 cut(s)	211, 334, 383, 581
Csp6I	GTAC	3 cut(s)	448, 541, 739
CviAII	CATG	3 cut(s)	295, 565, 637
CviQI	GTAC	3 cut(s)	448, 541, 739
DdeI	CTNAG	1 cut(s)	518
DinI	GGCGCC	3 cut(s)	61, 252, 600
DpnI	GATC	4 cut(s)	218, 563, 569, 658
DpnII	GATC	4 cut(s)	216, 561, 567, 656
EaeI	YGGCCR	1 cut(s)	639
EciI	GGCGGA	1 cut(s)	443
Eco31I	GGTCTC	1 cut(s)	389
Eco47I	GGWCC	5 cut(s)	235, 343, 355, 484, 556
Eco57I	CTGAAG	3 cut(s)	41, 389, 768
Eco72I	CACGTG	1 cut(s)	673
Eco88I	CYCGRG	1 cut(s)	593
EcoNI	CCTNNNNNAGG	2 cut(s)	338, 746
EcoO109I	RGGNCCY	3 cut(s)	235, 343, 556
EcoRII	CCWGG	3 cut(s)	159, 601, 641
EgeI	GGCGCC	3 cut(s)	61, 252, 600
EheI	GGCGCC	3 cut(s)	61, 252, 600
Esp3I	CGTCTC	1 cut(s)	229
FaeI	CATG	3 cut(s)	298, 568, 640
FaiI	YATR	6 cut(s)	138, 189, 296, 566, 620, 638
FaqI	GGGAC	2 cut(s)	169, 569
FatI	CATG	3 cut(s)	294, 564, 636
FauI	CCCGC	5 cut(s)	204, 240, 381, 573, 645
FbaI	TGATCA	1 cut(s)	561
FblI	GTMKAC	1 cut(s)	690
Fnu4HI	GCNGC	9 cut(s)	36, 63, 200, 319, 437, 578, 615, 630, 789
FokI	GGATG	2 cut(s)	350, 622
Fsp4HI	GCNGC	9 cut(s)	36, 63, 200, 319, 437, 578, 615, 630, 789
FspBI	CTAG	1 cut(s)	278
GlaI	GCGC	7 cut(s)	61, 66, 252, 378, 516, 576, 600
GluI	GCNGC	9 cut(s)	36, 63, 200, 319, 437, 578, 615, 630, 789
GsuI	CTGGAG	2 cut(s)	61, 143
HaeII	RGCGCY	4 cut(s)	63, 254, 518, 602
HaeIII	GGCC	5 cut(s)	282, 302, 392, 641, 752
HapII	CCGG	8 cut(s)	87, 93, 380, 461, 477, 530, 694, 733
HgaI	GACGC	4 cut(s)	211, 334, 383, 581
HhaI	GCGC	7 cut(s)	62, 67, 253, 379, 517, 577, 601
Hin1I	GRCGYC	4 cut(s)	60, 222, 251, 599
Hin1II	CATG	3 cut(s)	298, 568, 640
Hin6I	GCGC	7 cut(s)	60, 65, 251, 377, 515, 575, 599
HinP1I	GCGC	7 cut(s)	60, 65, 251, 377, 515, 575, 599
HincII	GTYRAC	1 cut(s)	130
HindII	GTYRAC	1 cut(s)	130
HinfI	GANTC	3 cut(s)	7, 287, 778
HpaII	CCGG	8 cut(s)	87, 93, 380, 461, 477, 530, 694, 733
Hpy166II	GTNNAC	4 cut(s)	130, 403, 541, 691
Hpy188I	TCNGA	4 cut(s)	12, 21, 457, 609
Hpy188III	TCNNGA	6 cut(s)	207, 358, 367, 565, 593, 757
Hpy8I	GTNNAC	4 cut(s)	130, 403, 541, 691
Hpy99I	CGWCG	4 cut(s)	328, 575, 689, 758
HpyAV	CCTTC	7 cut(s)	16, 112, 238, 364, 691, 700, 792
HpyCH4III	ACNGT	1 cut(s)	400
HpyCH4IV	ACGT	4 cut(s)	182, 490, 672, 687
HpyCH4V	TGCA	4 cut(s)	258, 472, 507, 682
HpyF10VI	GCNNNNNNNGC	6 cut(s)	219, 385, 421, 508, 638, 794
HpyF3I	CTNAG	1 cut(s)	518
HpySE526I	ACGT	4 cut(s)	182, 490, 672, 687
Hsp92I	GRCGYC	4 cut(s)	60, 222, 251, 599
Hsp92II	CATG	3 cut(s)	298, 568, 640
HspAI	GCGC	7 cut(s)	60, 65, 251, 377, 515, 575, 599
KasI	GGCGCC	3 cut(s)	59, 250, 598
Ksp22I	TGATCA	1 cut(s)	561
KspI	CCGCGG	1 cut(s)	581
Kzo9I	GATC	4 cut(s)	216, 561, 567, 656
LmnI	GCTCC	3 cut(s)	12, 162, 174
Lsp1109I	GCAGC	3 cut(s)	22, 211, 423
MaeI	CTAG	1 cut(s)	278
MaeII	ACGT	4 cut(s)	182, 490, 672, 687
MalI	GATC	4 cut(s)	218, 563, 569, 658
MbiI	CCGCTC	1 cut(s)	502
MboI	GATC	4 cut(s)	216, 561, 567, 656
MboII	GAAGA	3 cut(s)	16, 40, 43
MhlI	GDGCHC	1 cut(s)	171
MlsI	TGGCCA	1 cut(s)	641
MluCI	AATT	1 cut(s)	122
MluNI	TGGCCA	1 cut(s)	641
Mly113I	GGCGCC	3 cut(s)	60, 251, 599
MlyI	GAGTC	1 cut(s)	281
MmeI	TCCRAC	1 cut(s)	587
Mox20I	TGGCCA	1 cut(s)	641
MscI	TGGCCA	1 cut(s)	641
MseI	TTAA	2 cut(s)	309, 747
MslI	CAYNNNNRTG	1 cut(s)	671
Msp20I	TGGCCA	1 cut(s)	641
MspA1I	CMGCKG	3 cut(s)	149, 580, 809
MspI	CCGG	8 cut(s)	87, 93, 380, 461, 477, 530, 694, 733
MspR9I	CCNGG	4 cut(s)	161, 478, 603, 643
MteI	GCGCNGCGC	1 cut(s)	63
MvaI	CCWGG	3 cut(s)	161, 603, 643
MvnI	CGCG	6 cut(s)	65, 247, 318, 377, 575, 580
MwoI	GCNNNNNNNGC	6 cut(s)	219, 385, 421, 508, 638, 794
NarI	GGCGCC	3 cut(s)	60, 251, 599
NciI	CCSGG	1 cut(s)	478
NdeII	GATC	4 cut(s)	216, 561, 567, 656
NlaIII	CATG	3 cut(s)	298, 568, 640
NlaIV	GGNNCC	9 cut(s)	61, 91, 97, 252, 345, 356, 557, 600, 664
NmeAIII	GCCGAG	4 cut(s)	36, 418, 605, 742
OliI	CACNNNNGTG	1 cut(s)	671
PagI	TCATGA	1 cut(s)	564
PcsI	WCGNNNNNNNCGW	3 cut(s)	188, 251, 540
PfeI	GAWTC	2 cut(s)	7, 778
PkrI	GCNGC	9 cut(s)	37, 64, 201, 320, 438, 579, 616, 631, 790
PleI	GAGTC	1 cut(s)	281
PluTI	GGCGCC	3 cut(s)	63, 254, 602
PmaCI	CACGTG	1 cut(s)	673
PmlI	CACGTG	1 cut(s)	673
PpsI	GAGTC	1 cut(s)	281
Ppu21I	YACGTR	2 cut(s)	491, 673
PpuMI	RGGWCCY	3 cut(s)	235, 343, 556
Psp5II	RGGWCCY	3 cut(s)	235, 343, 556
Psp6I	CCWGG	3 cut(s)	159, 601, 641
PspCI	CACGTG	1 cut(s)	673
PspGI	CCWGG	3 cut(s)	159, 601, 641
PspN4I	GGNNCC	9 cut(s)	61, 91, 97, 252, 345, 356, 557, 600, 664
PspPI	GGNCC	7 cut(s)	235, 300, 343, 355, 390, 484, 556
PspPPI	RGGWCCY	3 cut(s)	235, 343, 556
RsaI	GTAC	3 cut(s)	449, 542, 740
RsaNI	GTAC	3 cut(s)	448, 541, 739
RseI	CAYNNNNRTG	1 cut(s)	671
SacII	CCGCGG	1 cut(s)	581
SaqAI	TTAA	2 cut(s)	309, 747
SatI	GCNGC	9 cut(s)	36, 63, 200, 319, 437, 578, 615, 630, 789
Sau3AI	GATC	4 cut(s)	216, 561, 567, 656
Sau96I	GGNCC	7 cut(s)	235, 300, 343, 355, 390, 484, 556
SchI	GAGTC	1 cut(s)	281
ScrFI	CCNGG	4 cut(s)	161, 478, 603, 643
SduI	GDGCHC	1 cut(s)	171
SfoI	GGCGCC	3 cut(s)	61, 252, 600
Sfr303I	CCGCGG	1 cut(s)	581
SgrBI	CCGCGG	1 cut(s)	581
SinI	GGWCC	5 cut(s)	235, 343, 355, 484, 556
SmiMI	CAYNNNNRTG	1 cut(s)	671
SmlI	CTYRAG	1 cut(s)	335
SmoI	CTYRAG	1 cut(s)	335
Sse9I	AATT	1 cut(s)	122
SspDI	GGCGCC	3 cut(s)	59, 250, 598
SspMI	CTAG	1 cut(s)	278
StyD4I	CCNGG	4 cut(s)	159, 476, 601, 641
TaaI	ACNGT	1 cut(s)	400
TaiI	ACGT	4 cut(s)	185, 493, 675, 690
TaqI	TCGA	3 cut(s)	206, 231, 570
TaqII	GACCGA	1 cut(s)	263
TasI	AATT	1 cut(s)	122
TauI	GCSGC	6 cut(s)	65, 321, 580, 617, 632, 791
TfiI	GAWTC	2 cut(s)	7, 778
Tru1I	TTAA	2 cut(s)	309, 747
Tru9I	TTAA	2 cut(s)	309, 747
TseI	GCWGC	3 cut(s)	35, 199, 436
TspDTI	ATGAA	1 cut(s)	17
VpaK11BI	GGWCC	5 cut(s)	235, 343, 355, 484, 556
XagI	CCTNNNNNAGG	2 cut(s)	338, 746
XapI	RAATTY	1 cut(s)	122
XmiI	GTMKAC	1 cut(s)	690
XspI	CTAG	1 cut(s)	278

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.