Rmu_sc0004235.1_g000003

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004235.1
Physical Location & Seq
Forward (+)
7887 .. 9133
1247 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004235.1_g000003.1.cds

Sequence Viewer

Length: 399 bp
atggcaacttcttctctttgtttgacaccagtttgttcattcaagtcctcaaacaaaccaggagtgttgattggaaatttgggtggtggtaaggttcttcgggtgaatgaagcatttcagaactcaaaagctgcaaagactcaatcttgggagatcaaggcaacagatggtaatcaaaccaccaaaagaaatagcatagtctgcgctgattgtgaaggaaatggtgctatagcatgttctcagtgcaaaggtactggagttaattctgtagaccacttcaacggacagttcaaagctggtgggctatgttggctttgcagaggtaaaagggagattctctgtggagattgcaatggtgctgggttcattggaggattcatgagcacacaggattcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

132

Amino Acids

13.73

Weight (kDa)

8.73

Isoelectric Point (pI)

30.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 270
AcsI RAATTY 1 cut(s) 76
AfaI GTAC 1 cut(s) 253
AgsI TTSAA 3 cut(s) 43, 280, 292
AjnI CCWGG 1 cut(s) 58
AluBI AGCT 2 cut(s) 131, 296
AluI AGCT 2 cut(s) 131, 296
Alw21I GWGCWC 1 cut(s) 386
ApeKI GCWGC 1 cut(s) 131
ApoI RAATTY 1 cut(s) 76
Asp700I GAANNNNTTC 1 cut(s) 114
AspLEI GCGC 1 cut(s) 206
AsuHPI GGTGA 1 cut(s) 115
BaeI ACNNNNGTAYC 2 cut(s) 243, 276
Bbv12I GWGCWC 1 cut(s) 386
BbvI GCAGC 1 cut(s) 118
BccI CCATC 1 cut(s) 161
BciT130I CCWGG 1 cut(s) 60
BfaI CTAG 1 cut(s) 397
BfmI CTRYAG 2 cut(s) 228, 267
BisI GCNGC 1 cut(s) 132
BlsI GCNGC 1 cut(s) 133
Bme1390I CCNGG 1 cut(s) 60
BmrFI CCNGG 1 cut(s) 60
BpmI CTGGAG 1 cut(s) 276
BsaBI GATNNNNATC 1 cut(s) 171
Bse1I ACTGG 2 cut(s) 29, 259
Bse3DI GCAATG 1 cut(s) 358
Bse8I GATNNNNATC 1 cut(s) 171
BseBI CCWGG 1 cut(s) 60
BseJI GATNNNNATC 1 cut(s) 171
BseMI GCAATG 1 cut(s) 358
BseMII CTCAG 1 cut(s) 254
BseNI ACTGG 2 cut(s) 29, 259
BseXI GCAGC 1 cut(s) 118
BseYI CCCAGC 1 cut(s) 359
BsiHKAI GWGCWC 1 cut(s) 386
Bsp1286I GDGCHC 1 cut(s) 386
Bsp143I GATC 1 cut(s) 153
BspCNI CTCAG 1 cut(s) 253
BspHI TCATGA 1 cut(s) 378
BsrDI GCAATG 1 cut(s) 358
BsrI ACTGG 2 cut(s) 29, 259
BssMI GATC 1 cut(s) 153
Bst2UI CCWGG 1 cut(s) 60
Bst4CI ACNGT 1 cut(s) 288
BstAPI GCANNNNNTGC 1 cut(s) 201
BstDEI CTNAG 1 cut(s) 240
BstHHI GCGC 1 cut(s) 206
BstKTI GATC 1 cut(s) 156
BstMBI GATC 1 cut(s) 153
BstMWI GCNNNNNNNGC 2 cut(s) 201, 310
BstNI CCWGG 1 cut(s) 60
BstNSI RCATGY 1 cut(s) 237
BstSCI CCNGG 1 cut(s) 58
BstSFI CTRYAG 2 cut(s) 228, 267
BstV1I GCAGC 1 cut(s) 118
BtsIMutI CAGTG 1 cut(s) 248
CciI TCATGA 1 cut(s) 378
CfoI GCGC 1 cut(s) 206
Csp6I GTAC 1 cut(s) 252
CspCI CAANNNNNGTGG 2 cut(s) 280, 315
CviAII CATG 2 cut(s) 234, 379
CviJI RGCY 4 cut(s) 131, 296, 304, 313
CviKI_1 RGCY 4 cut(s) 131, 296, 304, 313
CviQI GTAC 1 cut(s) 252
DdeI CTNAG 1 cut(s) 240
DpnI GATC 1 cut(s) 155
DpnII GATC 1 cut(s) 153
EcoRII CCWGG 1 cut(s) 58
FaeI CATG 2 cut(s) 237, 382
FaiI YATR 5 cut(s) 197, 230, 235, 307, 380
FatI CATG 2 cut(s) 233, 378
FblI GTMKAC 1 cut(s) 270
Fnu4HI GCNGC 1 cut(s) 132
Fsp4HI GCNGC 1 cut(s) 132
FspBI CTAG 1 cut(s) 397
GlaI GCGC 1 cut(s) 205
GluI GCNGC 1 cut(s) 132
GsaI CCCAGC 1 cut(s) 363
GsuI CTGGAG 1 cut(s) 276
HhaI GCGC 1 cut(s) 206
Hin1II CATG 2 cut(s) 237, 382
Hin6I GCGC 1 cut(s) 204
HinP1I GCGC 1 cut(s) 204
HinfI GANTC 4 cut(s) 139, 334, 375, 392
HphI GGTGA 1 cut(s) 115
Hpy166II GTNNAC 1 cut(s) 271
Hpy188I TCNGA 1 cut(s) 120
Hpy188III TCNNGA 1 cut(s) 379
Hpy8I GTNNAC 1 cut(s) 271
HpyAV CCTTC 1 cut(s) 209
HpyCH4III ACNGT 1 cut(s) 288
HpyCH4V TGCA 4 cut(s) 134, 246, 318, 351
HpyF10VI GCNNNNNNNGC 2 cut(s) 201, 310
HpyF3I CTNAG 1 cut(s) 240
Hsp92II CATG 2 cut(s) 237, 382
HspAI GCGC 1 cut(s) 204
Kzo9I GATC 1 cut(s) 153
LpnPI CCDG 7 cut(s) 42, 45, 72, 240, 282, 345, 374
Lsp1109I GCAGC 1 cut(s) 118
MaeI CTAG 1 cut(s) 397
MalI GATC 1 cut(s) 155
MboI GATC 1 cut(s) 153
MboII GAAGA 2 cut(s) 3, 89
MhlI GDGCHC 1 cut(s) 386
MluCI AATT 2 cut(s) 76, 262
MlyI GAGTC 1 cut(s) 133
MnlI CCTC 3 cut(s) 58, 314, 365
MroXI GAANNNNTTC 1 cut(s) 114
MseI TTAA 1 cut(s) 261
MspR9I CCNGG 1 cut(s) 60
MvaI CCWGG 1 cut(s) 60
MwoI GCNNNNNNNGC 2 cut(s) 201, 310
NdeII GATC 1 cut(s) 153
NlaIII CATG 2 cut(s) 237, 382
NspI RCATGY 1 cut(s) 237
PagI TCATGA 1 cut(s) 378
PdmI GAANNNNTTC 1 cut(s) 114
PfeI GAWTC 3 cut(s) 334, 375, 392
PkrI GCNGC 1 cut(s) 133
PleI GAGTC 1 cut(s) 133
PpsI GAGTC 1 cut(s) 133
Psp6I CCWGG 1 cut(s) 58
PspFI CCCAGC 1 cut(s) 359
PspGI CCWGG 1 cut(s) 58
RsaI GTAC 1 cut(s) 253
RsaNI GTAC 1 cut(s) 252
SaqAI TTAA 1 cut(s) 261
SatI GCNGC 1 cut(s) 132
Sau3AI GATC 1 cut(s) 153
SchI GAGTC 1 cut(s) 133
ScrFI CCNGG 1 cut(s) 60
SduI GDGCHC 1 cut(s) 386
SetI ASST 5 cut(s) 96, 133, 253, 298, 325
SfcI CTRYAG 2 cut(s) 228, 267
Sse9I AATT 2 cut(s) 76, 262
SspMI CTAG 1 cut(s) 397
StyD4I CCNGG 1 cut(s) 58
TaaI ACNGT 1 cut(s) 288
TasI AATT 2 cut(s) 76, 262
TfiI GAWTC 3 cut(s) 334, 375, 392
Tru1I TTAA 1 cut(s) 261
Tru9I TTAA 1 cut(s) 261
TscAI CASTG 1 cut(s) 248
TseI GCWGC 1 cut(s) 131
TspDTI ATGAA 4 cut(s) 27, 123, 355, 367
TspGWI ACGGA 1 cut(s) 297
TspRI CASTG 1 cut(s) 248
XapI RAATTY 1 cut(s) 76
XceI RCATGY 1 cut(s) 237
XmiI GTMKAC 1 cut(s) 270
XmnI GAANNNNTTC 1 cut(s) 114
XspI CTAG 1 cut(s) 397
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.