Rw6G033940

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
Physical Location & Seq
Reverse (-)
58493226 .. 58494448
1223 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G033940.1

Sequence Viewer

Length: 312 bp
ATGGCCTATGCTCTCTACTCAGCTCCTTTAAGTTCCTTCAAGGCCACACCAGCACCAGGTATTCATAGCAGTAACCAGAAGCTCAGTCATATAAACTACTTCATAAATAGTTCTCCAGCTGCTAAAGTCTTCCATGTGAAGGCTAAGGCTGCCAAAAGTGATGAAAGCACAAAGCGAAACAGCATGGTTTGTTCTGATTGTGAGGGAAATGGTGCAGTTCTCTGCTCTCAATGCAAAGGCAGTGGAGTAAACTCCGATGATCTGTTTAGTGGACAGTTTAAAGCTGGGGATTCATGCTGGCTTTGCGGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

10.83

Weight (kDa)

8.56

Isoelectric Point (pI)

41.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
BSD2_CRD PF25436 60 - 103 8.6e-21 BSD2 cysteine rich domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 306
AfiI CCNNNNNNNGG 2 cut(s) 56, 139
AgsI TTSAA 1 cut(s) 40
AjnI CCWGG 1 cut(s) 55
AluBI AGCT 4 cut(s) 23, 82, 119, 284
AluI AGCT 4 cut(s) 23, 82, 119, 284
AoxI GGCC 2 cut(s) 3, 42
ApeKI GCWGC 2 cut(s) 119, 149
BbsI GAAGAC 1 cut(s) 121
BbvI GCAGC 2 cut(s) 106, 136
BciT130I CCWGG 1 cut(s) 57
BisI GCNGC 2 cut(s) 120, 150
BlsI GCNGC 2 cut(s) 121, 151
Bme1390I CCNGG 1 cut(s) 57
BmrFI CCNGG 1 cut(s) 57
BpiI GAAGAC 1 cut(s) 121
BpmI CTGGAG 1 cut(s) 99
Bpu10I CCTNAGC 1 cut(s) 144
Bsc4I CCNNNNNNNGG 2 cut(s) 56, 139
BseBI CCWGG 1 cut(s) 57
BseLI CCNNNNNNNGG 2 cut(s) 56, 139
BseMII CTCAG 2 cut(s) 33, 97
BseXI GCAGC 2 cut(s) 106, 136
BseYI CCCAGC 1 cut(s) 284
BsgI GTGCAG 1 cut(s) 234
BshFI GGCC 2 cut(s) 5, 44
BslI CCNNNNNNNGG 2 cut(s) 56, 139
BsnI GGCC 2 cut(s) 5, 44
Bsp143I GATC 1 cut(s) 259
BspACI CCGC 1 cut(s) 306
BspANI GGCC 2 cut(s) 5, 44
BspCNI CTCAG 2 cut(s) 32, 96
BssMI GATC 1 cut(s) 259
Bst2UI CCWGG 1 cut(s) 57
Bst4CI ACNGT 1 cut(s) 276
BstC8I GCNNGC 1 cut(s) 299
BstDEI CTNAG 3 cut(s) 19, 83, 144
BstKTI GATC 1 cut(s) 262
BstMBI GATC 1 cut(s) 259
BstMWI GCNNNNNNNGC 4 cut(s) 50, 149, 231, 303
BstNI CCWGG 1 cut(s) 57
BstSCI CCNGG 1 cut(s) 55
BstV1I GCAGC 2 cut(s) 106, 136
BstV2I GAAGAC 1 cut(s) 121
BsuRI GGCC 2 cut(s) 5, 44
BtsI GCAGTG 1 cut(s) 247
BtsIMutI CAGTG 1 cut(s) 247
Cac8I GCNNGC 1 cut(s) 299
CsiI ACCWGGT 1 cut(s) 55
CspCI CAANNNNNGTGG 2 cut(s) 223, 258
CviAII CATG 3 cut(s) 134, 184, 294
CviJI RGCY 9 cut(s) 5, 23, 44, 82, 119, 143, 149, 284, 301
CviKI_1 RGCY 9 cut(s) 5, 23, 44, 82, 119, 143, 149, 284, 301
DdeI CTNAG 3 cut(s) 19, 83, 144
DpnI GATC 1 cut(s) 261
DpnII GATC 1 cut(s) 259
DraI TTTAAA 1 cut(s) 280
EcoRII CCWGG 1 cut(s) 55
FaeI CATG 3 cut(s) 137, 187, 297
FaiI YATR 8 cut(s) 9, 66, 90, 92, 104, 135, 185, 295
FatI CATG 3 cut(s) 133, 183, 293
FauI CCCGC 1 cut(s) 299
Fnu4HI GCNGC 2 cut(s) 120, 150
Fsp4HI GCNGC 2 cut(s) 120, 150
GluI GCNGC 2 cut(s) 120, 150
GsaI CCCAGC 1 cut(s) 288
GsuI CTGGAG 1 cut(s) 99
HaeIII GGCC 2 cut(s) 5, 44
Hin1II CATG 3 cut(s) 137, 187, 297
HinfI GANTC 1 cut(s) 290
Hpy166II GTNNAC 2 cut(s) 250, 272
Hpy188I TCNGA 2 cut(s) 196, 256
Hpy8I GTNNAC 2 cut(s) 250, 272
HpyAV CCTTC 2 cut(s) 46, 133
HpyCH4III ACNGT 1 cut(s) 276
HpyCH4V TGCA 2 cut(s) 215, 234
HpyF10VI GCNNNNNNNGC 4 cut(s) 50, 149, 231, 303
HpyF3I CTNAG 3 cut(s) 19, 83, 144
Hsp92II CATG 3 cut(s) 137, 187, 297
Kzo9I GATC 1 cut(s) 259
LmnI GCTCC 1 cut(s) 28
LpnPI CCDG 7 cut(s) 42, 63, 69, 89, 129, 270, 283
Lsp1109I GCAGC 2 cut(s) 106, 136
MabI ACCWGGT 1 cut(s) 55
MaeIII GTNAC 1 cut(s) 71
MalI GATC 1 cut(s) 261
MboI GATC 1 cut(s) 259
MboII GAAGA 1 cut(s) 121
MnlI CCTC 1 cut(s) 196
MseI TTAA 2 cut(s) 29, 279
MspA1I CMGCKG 1 cut(s) 119
MspR9I CCNGG 1 cut(s) 57
MvaI CCWGG 1 cut(s) 57
MwoI GCNNNNNNNGC 4 cut(s) 50, 149, 231, 303
NdeII GATC 1 cut(s) 259
NlaIII CATG 3 cut(s) 137, 187, 297
PfeI GAWTC 1 cut(s) 290
PkrI GCNGC 2 cut(s) 121, 151
Psp6I CCWGG 1 cut(s) 55
PspFI CCCAGC 1 cut(s) 284
PspGI CCWGG 1 cut(s) 55
PvuII CAGCTG 1 cut(s) 119
SaqAI TTAA 2 cut(s) 29, 279
SatI GCNGC 2 cut(s) 120, 150
Sau3AI GATC 1 cut(s) 259
ScrFI CCNGG 1 cut(s) 57
SetI ASST 5 cut(s) 25, 61, 84, 121, 286
SexAI ACCWGGT 1 cut(s) 55
SsiI CCGC 1 cut(s) 306
StyD4I CCNGG 1 cut(s) 55
TaaI ACNGT 1 cut(s) 276
TfiI GAWTC 1 cut(s) 290
Tru1I TTAA 2 cut(s) 29, 279
Tru9I TTAA 2 cut(s) 29, 279
TscAI CASTG 1 cut(s) 247
TseI GCWGC 2 cut(s) 119, 149
TspDTI ATGAA 4 cut(s) 53, 91, 177, 282
TspRI CASTG 1 cut(s) 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.