Rmu_sc0004267.1_g000015

Protein of unknown function, DUF599

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004267.1
Physical Location & Seq
Forward (+)
73164 .. 74179
1016 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004267.1_g000015.1.cds

Sequence Viewer

Length: 672 bp
atgggaacttttactttagacactattcttgttcccttgagcctcttcgttctaatagcttaccatgcatatttatggtgtatcttcaagaccaaaccctctcacacaaccatcggaattgaatcagtcagaagaagaatatggtttctagagattatgcagggtgatggtcggaaggctatgttggcagtccaaaacttgagaaatactcaaatggtggcaataatcacagcttcaacagcaattgccttcagcttggctttggcagctctgacgaacaatgcttacaatgcaagccacctctttgttaaaacagcatttttcggcttgcagtcggggaggatctttgccctaaagtatggcttggcctattttgtcttgctgttcagctcattatgcagctccatggccactggatttatgatcgatgccatttttctagtaaatacttctcccgagttctcatcttcaggaataacactactcctatttgaacgaggttacatgttggctcaaattggcgaaaggttgctttgtatctcctttcctttgttgttgtggttgtttggtccagtgccagtggccttgtcatccctggccttggtttggtggcttaaagagcttgattttgttggcaaattcacccaaagtaacaggcaaagtctcagctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

223

Amino Acids

24.83

Weight (kDa)

9.44

Isoelectric Point (pI)

38.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 350
AcoI YGGCCR 1 cut(s) 408
AcsI RAATTY 1 cut(s) 638
AcuI CTGAAG 2 cut(s) 235, 453
AfiI CCNNNNNNNGG 2 cut(s) 601, 606
AflIII ACRYGT 1 cut(s) 504
AgsI TTSAA 4 cut(s) 88, 122, 237, 494
AjnI CCWGG 1 cut(s) 594
AjuI GAANNNNNNNTTGG 2 cut(s) 167, 199
AluBI AGCT 8 cut(s) 59, 233, 255, 269, 390, 402, 622, 669
AluI AGCT 8 cut(s) 59, 233, 255, 269, 390, 402, 622, 669
Alw26I GTCTC 1 cut(s) 668
AlwI GGATC 1 cut(s) 350
Ama87I CYCGRG 1 cut(s) 455
AoxI GGCC 4 cut(s) 366, 408, 582, 597
ApeKI GCWGC 2 cut(s) 266, 399
ApoI RAATTY 1 cut(s) 638
AspS9I GGNCC 1 cut(s) 569
AsuHPI GGTGA 2 cut(s) 176, 634
AvaI CYCGRG 1 cut(s) 455
AvaII GGWCC 1 cut(s) 569
BalI TGGCCA 1 cut(s) 410
BbvI GCAGC 2 cut(s) 278, 411
BccI CCATC 2 cut(s) 119, 161
BciT130I CCWGG 1 cut(s) 596
BcoDI GTCTC 1 cut(s) 668
BfaI CTAG 2 cut(s) 149, 440
BisI GCNGC 2 cut(s) 267, 400
BlsI GCNGC 2 cut(s) 268, 401
Bme1390I CCNGG 1 cut(s) 596
Bme18I GGWCC 1 cut(s) 569
BmeT110I CYCGRG 1 cut(s) 455
BmgT120I GGNCC 1 cut(s) 569
BmrFI CCNGG 1 cut(s) 596
BmsI GCATC 1 cut(s) 418
BplI GAGNNNNNCTC 2 cut(s) 193, 225
BpuEI CTTGAG 2 cut(s) 58, 220
Bsa29I ATCGAT 1 cut(s) 426
BsaJI CCNNGG 3 cut(s) 405, 594, 600
Bsc4I CCNNNNNNNGG 2 cut(s) 601, 606
Bse1I ACTGG 3 cut(s) 418, 572, 578
BseBI CCWGG 1 cut(s) 596
BseCI ATCGAT 1 cut(s) 426
BseDI CCNNGG 3 cut(s) 405, 594, 600
BseGI GGATG 1 cut(s) 590
BseLI CCNNNNNNNGG 2 cut(s) 601, 606
BseNI ACTGG 3 cut(s) 418, 572, 578
BseXI GCAGC 2 cut(s) 278, 411
BshFI GGCC 4 cut(s) 368, 410, 584, 599
BshVI ATCGAT 1 cut(s) 426
BsiHKCI CYCGRG 1 cut(s) 455
BslI CCNNNNNNNGG 2 cut(s) 601, 606
BsmAI GTCTC 1 cut(s) 668
BsnI GGCC 4 cut(s) 368, 410, 584, 599
BsoBI CYCGRG 1 cut(s) 455
Bsp143I GATC 2 cut(s) 342, 423
Bsp19I CCATGG 1 cut(s) 405
BspANI GGCC 4 cut(s) 368, 410, 584, 599
BspDI ATCGAT 1 cut(s) 426
BspPI GGATC 1 cut(s) 350
BsrI ACTGG 3 cut(s) 418, 572, 578
BssECI CCNNGG 3 cut(s) 405, 594, 600
BssMI GATC 2 cut(s) 342, 423
BssT1I CCWWGG 2 cut(s) 405, 600
Bst2UI CCWGG 1 cut(s) 596
Bst6I CTCTTC 1 cut(s) 50
BstC8I GCNNGC 2 cut(s) 295, 329
BstDEI CTNAG 1 cut(s) 665
BstDSI CCRYGG 1 cut(s) 405
BstF5I GGATG 1 cut(s) 590
BstKTI GATC 2 cut(s) 345, 426
BstMAI GTCTC 1 cut(s) 668
BstMBI GATC 2 cut(s) 342, 423
BstMWI GCNNNNNNNGC 7 cut(s) 65, 185, 239, 266, 290, 396, 619
BstNI CCWGG 1 cut(s) 596
BstNSI RCATGY 1 cut(s) 508
BstSCI CCNGG 1 cut(s) 594
BstV1I GCAGC 2 cut(s) 278, 411
BstX2I RGATCY 1 cut(s) 342
BstYI RGATCY 1 cut(s) 342
Bsu15I ATCGAT 1 cut(s) 426
BsuRI GGCC 4 cut(s) 368, 410, 584, 599
BsuTUI ATCGAT 1 cut(s) 426
BtgI CCRYGG 1 cut(s) 405
BtsCI GGATG 1 cut(s) 590
BtsIMutI CAGTG 3 cut(s) 411, 579, 585
Cac8I GCNNGC 2 cut(s) 295, 329
Cfr13I GGNCC 1 cut(s) 569
ClaI ATCGAT 1 cut(s) 426
CviAII CATG 3 cut(s) 65, 406, 505
DdeI CTNAG 1 cut(s) 665
DpnI GATC 2 cut(s) 344, 425
DpnII GATC 2 cut(s) 342, 423
EaeI YGGCCR 1 cut(s) 408
Eam1104I CTCTTC 1 cut(s) 50
EarI CTCTTC 1 cut(s) 50
Eco130I CCWWGG 2 cut(s) 405, 600
Eco47I GGWCC 1 cut(s) 569
Eco57I CTGAAG 2 cut(s) 235, 453
Eco88I CYCGRG 1 cut(s) 455
EcoRII CCWGG 1 cut(s) 594
EcoT14I CCWWGG 2 cut(s) 405, 600
EcoT22I ATGCAT 1 cut(s) 70
ErhI CCWWGG 2 cut(s) 405, 600
FaeI CATG 3 cut(s) 68, 409, 508
FalI AAGNNNNNCTT 2 cut(s) 347, 379
FatI CATG 3 cut(s) 64, 405, 504
Fnu4HI GCNGC 2 cut(s) 267, 400
FokI GGATG 1 cut(s) 577
Fsp4HI GCNGC 2 cut(s) 267, 400
FspBI CTAG 2 cut(s) 149, 440
GluI GCNGC 2 cut(s) 267, 400
HaeIII GGCC 4 cut(s) 368, 410, 584, 599
Hin1II CATG 3 cut(s) 68, 409, 508
HinfI GANTC 1 cut(s) 122
HphI GGTGA 2 cut(s) 176, 634
Hpy188I TCNGA 4 cut(s) 116, 131, 174, 273
Hpy188III TCNNGA 4 cut(s) 88, 149, 455, 471
HpyAV CCTTC 2 cut(s) 169, 259
HpyCH4V TGCA 5 cut(s) 68, 160, 293, 331, 399
HpyF10VI GCNNNNNNNGC 7 cut(s) 65, 185, 239, 266, 290, 396, 619
HpyF3I CTNAG 1 cut(s) 665
Hsp92II CATG 3 cut(s) 68, 409, 508
Kzo9I GATC 2 cut(s) 342, 423
LmnI GCTCC 1 cut(s) 407
LpnPI CCDG 8 cut(s) 146, 399, 456, 581, 585, 591, 608, 640
Lsp1109I GCAGC 2 cut(s) 278, 411
LweI GCATC 1 cut(s) 418
MaeI CTAG 2 cut(s) 149, 440
MaeIII GTNAC 2 cut(s) 500, 650
MalI GATC 2 cut(s) 344, 425
MboI GATC 2 cut(s) 342, 423
MboII GAAGA 5 cut(s) 37, 76, 144, 147, 459
MfeI CAATTG 1 cut(s) 243
MflI RGATCY 1 cut(s) 342
MlsI TGGCCA 1 cut(s) 410
MluCI AATT 4 cut(s) 117, 243, 516, 638
MluNI TGGCCA 1 cut(s) 410
MmeI TCCRAC 1 cut(s) 152
MnlI CCTC 5 cut(s) 53, 109, 311, 333, 491
Mox20I TGGCCA 1 cut(s) 410
Mph1103I ATGCAT 1 cut(s) 70
MscI TGGCCA 1 cut(s) 410
MseI TTAA 2 cut(s) 309, 615
MslI CAYNNNNRTG 1 cut(s) 73
Msp20I TGGCCA 1 cut(s) 410
MspA1I CMGCKG 1 cut(s) 669
MspR9I CCNGG 1 cut(s) 596
MunI CAATTG 1 cut(s) 243
MvaI CCWGG 1 cut(s) 596
MwoI GCNNNNNNNGC 7 cut(s) 65, 185, 239, 266, 290, 396, 619
NcoI CCATGG 1 cut(s) 405
NdeII GATC 2 cut(s) 342, 423
NlaIII CATG 3 cut(s) 68, 409, 508
NsiI ATGCAT 1 cut(s) 70
NspI RCATGY 1 cut(s) 508
PciI ACATGT 1 cut(s) 504
PfeI GAWTC 1 cut(s) 122
PkrI GCNGC 2 cut(s) 268, 401
PscI ACATGT 1 cut(s) 504
Psp6I CCWGG 1 cut(s) 594
PspGI CCWGG 1 cut(s) 594
PspPI GGNCC 1 cut(s) 569
PsrI GAACNNNNNNTAC 2 cut(s) 269, 301
PsuI RGATCY 1 cut(s) 342
PvuII CAGCTG 1 cut(s) 669
RseI CAYNNNNRTG 1 cut(s) 73
SaqAI TTAA 2 cut(s) 309, 615
SatI GCNGC 2 cut(s) 267, 400
Sau3AI GATC 2 cut(s) 342, 423
Sau96I GGNCC 1 cut(s) 569
ScrFI CCNGG 1 cut(s) 596
SfaNI GCATC 1 cut(s) 418
SinI GGWCC 1 cut(s) 569
SmiMI CAYNNNNRTG 1 cut(s) 73
SmlI CTYRAG 2 cut(s) 37, 199
SmoI CTYRAG 2 cut(s) 37, 199
Sse9I AATT 4 cut(s) 117, 243, 516, 638
SspMI CTAG 2 cut(s) 149, 440
StyD4I CCNGG 1 cut(s) 594
StyI CCWWGG 2 cut(s) 405, 600
TaqI TCGA 1 cut(s) 426
TasI AATT 4 cut(s) 117, 243, 516, 638
TfiI GAWTC 1 cut(s) 122
Tru1I TTAA 2 cut(s) 309, 615
Tru9I TTAA 2 cut(s) 309, 615
TscAI CASTG 3 cut(s) 418, 579, 585
TseI GCWGC 2 cut(s) 266, 399
TspRI CASTG 3 cut(s) 418, 579, 585
VpaK11BI GGWCC 1 cut(s) 569
XapI RAATTY 1 cut(s) 638
XbaI TCTAGA 1 cut(s) 148
XceI RCATGY 1 cut(s) 508
XspI CTAG 2 cut(s) 149, 440
Zsp2I ATGCAT 1 cut(s) 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.