Rroxscaffold_6G00419540

Protein of unknown function, DUF599

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
40977049 .. 40978662
1614 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00419540.1

Sequence Viewer

Length: 402 bp
ATGTTTTCCTCAGACTTGGAACGTCTAAGATACAGGTTTGCTTTCACCGATATTCTATGTTTTTTGAGAAATATAGTGGGGATGATGAGATGGGGAGATGAAGTGCGTCGGGGAGGATCTTTGCCCCTAAAGTATGGCTTGGCTTATTTCGTTTTGCTGTTCAGCTCATTATGCAGCTCCATGGCCACTGGATTTATGATCGATGCCATTTTTCTACTAAATACTTCTGCCGAGTTCTCATCTTCAGGAATAACACTACTCCTATTTGAACGAGGTTACATGTTGGCTCAAATTGGCGAAAGGTTGCTTTGTATCTCCTTTCCTTTGTTGTTGTGGTTGTTTGGTCCAGTGCCAGTGGCCTTGTCATCCCTGGCCTTGGTTTGGTGGCTTAAAAGAGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

133

Amino Acids

15.11

Weight (kDa)

8.98

Isoelectric Point (pI)

43.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF599 PF04654 42 - 132 3e-13 Protein of unknown function, DUF599
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 124
AcoI YGGCCR 1 cut(s) 183
AcuI CTGAAG 1 cut(s) 228
AfiI CCNNNNNNNGG 2 cut(s) 376, 381
AflIII ACRYGT 1 cut(s) 279
AgsI TTSAA 1 cut(s) 269
AjnI CCWGG 1 cut(s) 369
AluBI AGCT 3 cut(s) 165, 177, 398
AluI AGCT 3 cut(s) 165, 177, 398
AlwI GGATC 1 cut(s) 124
AoxI GGCC 3 cut(s) 183, 357, 372
ApeKI GCWGC 1 cut(s) 174
AspS9I GGNCC 1 cut(s) 344
AsuHPI GGTGA 1 cut(s) 37
AvaII GGWCC 1 cut(s) 344
BalI TGGCCA 1 cut(s) 185
BbvI GCAGC 1 cut(s) 186
BccI CCATC 1 cut(s) 84
BciT130I CCWGG 1 cut(s) 371
BisI GCNGC 1 cut(s) 175
BlsI GCNGC 1 cut(s) 176
Bme1390I CCNGG 1 cut(s) 371
Bme18I GGWCC 1 cut(s) 344
BmgT120I GGNCC 1 cut(s) 344
BmrFI CCNGG 1 cut(s) 371
BmsI GCATC 1 cut(s) 193
Bsa29I ATCGAT 1 cut(s) 201
BsaJI CCNNGG 3 cut(s) 180, 369, 375
BsaXI ACNNNNNCTCC 2 cut(s) 87, 117
Bsc4I CCNNNNNNNGG 2 cut(s) 376, 381
Bse1I ACTGG 3 cut(s) 193, 347, 353
BseBI CCWGG 1 cut(s) 371
BseCI ATCGAT 1 cut(s) 201
BseDI CCNNGG 3 cut(s) 180, 369, 375
BseGI GGATG 2 cut(s) 87, 365
BseLI CCNNNNNNNGG 2 cut(s) 376, 381
BseMII CTCAG 1 cut(s) 24
BseNI ACTGG 3 cut(s) 193, 347, 353
BseXI GCAGC 1 cut(s) 186
BshFI GGCC 3 cut(s) 185, 359, 374
BshVI ATCGAT 1 cut(s) 201
BslI CCNNNNNNNGG 2 cut(s) 376, 381
BsnI GGCC 3 cut(s) 185, 359, 374
Bsp143I GATC 2 cut(s) 116, 198
Bsp19I CCATGG 1 cut(s) 180
BspANI GGCC 3 cut(s) 185, 359, 374
BspCNI CTCAG 1 cut(s) 23
BspDI ATCGAT 1 cut(s) 201
BspPI GGATC 1 cut(s) 124
BsrI ACTGG 3 cut(s) 193, 347, 353
BssECI CCNNGG 3 cut(s) 180, 369, 375
BssMI GATC 2 cut(s) 116, 198
BssT1I CCWWGG 2 cut(s) 180, 375
Bst2UI CCWGG 1 cut(s) 371
BstDEI CTNAG 2 cut(s) 10, 26
BstDSI CCRYGG 1 cut(s) 180
BstF5I GGATG 2 cut(s) 87, 365
BstKTI GATC 2 cut(s) 119, 201
BstMBI GATC 2 cut(s) 116, 198
BstMWI GCNNNNNNNGC 1 cut(s) 171
BstNI CCWGG 1 cut(s) 371
BstNSI RCATGY 1 cut(s) 283
BstSCI CCNGG 1 cut(s) 369
BstV1I GCAGC 1 cut(s) 186
BstX2I RGATCY 1 cut(s) 116
BstYI RGATCY 1 cut(s) 116
Bsu15I ATCGAT 1 cut(s) 201
BsuRI GGCC 3 cut(s) 185, 359, 374
BsuTUI ATCGAT 1 cut(s) 201
BtgI CCRYGG 1 cut(s) 180
BtsCI GGATG 2 cut(s) 87, 365
BtsIMutI CAGTG 3 cut(s) 186, 354, 360
Cfr13I GGNCC 1 cut(s) 344
ClaI ATCGAT 1 cut(s) 201
CseI GACGC 1 cut(s) 95
CviAII CATG 2 cut(s) 181, 280
DdeI CTNAG 2 cut(s) 10, 26
DpnI GATC 2 cut(s) 118, 200
DpnII GATC 2 cut(s) 116, 198
EaeI YGGCCR 1 cut(s) 183
Eco130I CCWWGG 2 cut(s) 180, 375
Eco47I GGWCC 1 cut(s) 344
Eco57I CTGAAG 1 cut(s) 228
EcoRII CCWGG 1 cut(s) 369
EcoT14I CCWWGG 2 cut(s) 180, 375
ErhI CCWWGG 2 cut(s) 180, 375
FaeI CATG 2 cut(s) 184, 283
FaiI YATR 7 cut(s) 58, 74, 135, 172, 182, 197, 281
FalI AAGNNNNNCTT 2 cut(s) 122, 154
FatI CATG 2 cut(s) 180, 279
Fnu4HI GCNGC 1 cut(s) 175
FokI GGATG 2 cut(s) 94, 352
Fsp4HI GCNGC 1 cut(s) 175
GluI GCNGC 1 cut(s) 175
HaeIII GGCC 3 cut(s) 185, 359, 374
HgaI GACGC 1 cut(s) 95
Hin1II CATG 2 cut(s) 184, 283
HphI GGTGA 1 cut(s) 37
Hpy188I TCNGA 1 cut(s) 13
Hpy188III TCNNGA 1 cut(s) 246
Hpy99I CGWCG 1 cut(s) 111
HpyCH4IV ACGT 1 cut(s) 22
HpyCH4V TGCA 1 cut(s) 174
HpyF10VI GCNNNNNNNGC 1 cut(s) 171
HpyF3I CTNAG 2 cut(s) 10, 26
HpySE526I ACGT 1 cut(s) 22
Hsp92II CATG 2 cut(s) 184, 283
Kzo9I GATC 2 cut(s) 116, 198
LmnI GCTCC 1 cut(s) 182
LpnPI CCDG 7 cut(s) 19, 174, 231, 356, 360, 366, 383
Lsp1109I GCAGC 1 cut(s) 186
LweI GCATC 1 cut(s) 193
MaeII ACGT 1 cut(s) 22
MaeIII GTNAC 1 cut(s) 275
MalI GATC 2 cut(s) 118, 200
MboI GATC 2 cut(s) 116, 198
MboII GAAGA 1 cut(s) 234
MflI RGATCY 1 cut(s) 116
MlsI TGGCCA 1 cut(s) 185
MluCI AATT 1 cut(s) 291
MluNI TGGCCA 1 cut(s) 185
MnlI CCTC 3 cut(s) 19, 107, 266
Mox20I TGGCCA 1 cut(s) 185
MscI TGGCCA 1 cut(s) 185
MseI TTAA 1 cut(s) 390
Msp20I TGGCCA 1 cut(s) 185
MspR9I CCNGG 1 cut(s) 371
MvaI CCWGG 1 cut(s) 371
MwoI GCNNNNNNNGC 1 cut(s) 171
NcoI CCATGG 1 cut(s) 180
NdeII GATC 2 cut(s) 116, 198
NlaIII CATG 2 cut(s) 184, 283
NmeAIII GCCGAG 1 cut(s) 256
NspI RCATGY 1 cut(s) 283
PciI ACATGT 1 cut(s) 279
PkrI GCNGC 1 cut(s) 176
PscI ACATGT 1 cut(s) 279
Psp6I CCWGG 1 cut(s) 369
PspGI CCWGG 1 cut(s) 369
PspPI GGNCC 1 cut(s) 344
PsuI RGATCY 1 cut(s) 116
SaqAI TTAA 1 cut(s) 390
SatI GCNGC 1 cut(s) 175
Sau3AI GATC 2 cut(s) 116, 198
Sau96I GGNCC 1 cut(s) 344
ScrFI CCNGG 1 cut(s) 371
SetI ASST 7 cut(s) 25, 38, 167, 179, 277, 305, 400
SfaNI GCATC 1 cut(s) 193
SinI GGWCC 1 cut(s) 344
Sse9I AATT 1 cut(s) 291
StyD4I CCNGG 1 cut(s) 369
StyI CCWWGG 2 cut(s) 180, 375
TaiI ACGT 1 cut(s) 25
TaqI TCGA 1 cut(s) 201
TasI AATT 1 cut(s) 291
Tru1I TTAA 1 cut(s) 390
Tru9I TTAA 1 cut(s) 390
TscAI CASTG 3 cut(s) 193, 354, 360
TseI GCWGC 1 cut(s) 174
TspDTI ATGAA 1 cut(s) 114
TspRI CASTG 3 cut(s) 193, 354, 360
VpaK11BI GGWCC 1 cut(s) 344
XceI RCATGY 1 cut(s) 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.