Rmu_sc0004469.1_g000016

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004469.1
OG0010596
Physical Location & Seq
Reverse (-)
50403 .. 52631
2229 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004469.1_g000016.1.cds

Sequence Viewer

Length: 501 bp
atgcagagggtgatagtcaccgacgaagaaatggagtacagtgtatgcttggaaagcttcaaagtctgcggtgaagccaagaagatgccttctaagctaagcactagaagatcgagaatccataaggagtcggattccggcaaccacggtcaaacaaaacaatatgtttggcaagagatcatcggcgaaggagaattcgggacgggccagcaccaaccttctcgtggatcccaatccaaaagaacccaaattgagaccccaaatcaaccacaaaagaatccaactttgagaatcagcaacgattcagatcaagaaatgcaactcgaaaaagaagaagaaagacttaccaagctgttgagatcaaaggagtctctggttggggaagtgaagatgaaagtgagggagaagaagaagaagatgacggctgaggcggtaatggtgaggactagcaatctaaaagtcgagcttcgctggaagtcatcaacgagcaagacgacgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

166

Amino Acids

19.13

Weight (kDa)

9.52

Isoelectric Point (pI)

58.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 69, 431
AclWI GGATC 2 cut(s) 222, 235
AcsI RAATTY 1 cut(s) 194
AfaI GTAC 1 cut(s) 38
AfiI CCNNNNNNNGG 1 cut(s) 224
AgsI TTSAA 1 cut(s) 61
AluBI AGCT 4 cut(s) 57, 97, 352, 466
AluI AGCT 4 cut(s) 57, 97, 352, 466
Alw26I GTCTC 2 cut(s) 248, 375
AlwI GGATC 2 cut(s) 222, 235
AoxI GGCC 1 cut(s) 205
ApoI RAATTY 1 cut(s) 194
AspS9I GGNCC 1 cut(s) 205
AsuHPI GGTGA 4 cut(s) 10, 22, 83, 451
BamHI GGATCC 1 cut(s) 227
BauI CACGAG 1 cut(s) 222
BbvCI CCTCAGC 1 cut(s) 426
BceAI ACGGC 1 cut(s) 438
BcoDI GTCTC 2 cut(s) 248, 375
BfaI CTAG 2 cut(s) 105, 447
BlpI GCTNAGC 1 cut(s) 98
BmgT120I GGNCC 1 cut(s) 205
BmiI GGNNCC 1 cut(s) 229
BmsI GCATC 1 cut(s) 75
Bpu10I CCTNAGC 1 cut(s) 426
Bpu1102I GCTNAGC 1 cut(s) 98
BsaBI GATNNNNATC 2 cut(s) 232, 306
BsaI GGTCTC 1 cut(s) 248
BsaJI CCNNGG 1 cut(s) 145
Bsc4I CCNNNNNNNGG 1 cut(s) 224
Bse8I GATNNNNATC 2 cut(s) 232, 306
BseDI CCNNGG 1 cut(s) 145
BseJI GATNNNNATC 2 cut(s) 232, 306
BseLI CCNNNNNNNGG 1 cut(s) 224
BseMII CTCAG 1 cut(s) 417
BshFI GGCC 1 cut(s) 207
BsiSI CCGG 1 cut(s) 138
BslFI GGGAC 1 cut(s) 214
BslI CCNNNNNNNGG 1 cut(s) 224
BsmAI GTCTC 2 cut(s) 248, 375
BsmFI GGGAC 1 cut(s) 214
BsnI GGCC 1 cut(s) 207
Bso31I GGTCTC 1 cut(s) 248
Bsp143I GATC 5 cut(s) 110, 177, 227, 307, 359
Bsp1720I GCTNAGC 1 cut(s) 98
BspACI CCGC 2 cut(s) 69, 431
BspANI GGCC 1 cut(s) 207
BspCNI CTCAG 1 cut(s) 418
BspLI GGNNCC 1 cut(s) 229
BspPI GGATC 2 cut(s) 222, 235
BspTNI GGTCTC 1 cut(s) 248
BssECI CCNNGG 1 cut(s) 145
BssMI GATC 5 cut(s) 110, 177, 227, 307, 359
BssSI CACGAG 1 cut(s) 222
Bst2BI CACGAG 1 cut(s) 222
Bst4CI ACNGT 2 cut(s) 41, 149
BstC8I GCNNGC 1 cut(s) 209
BstDEI CTNAG 3 cut(s) 93, 98, 426
BstDSI CCRYGG 1 cut(s) 145
BstKTI GATC 5 cut(s) 113, 180, 230, 310, 362
BstMAI GTCTC 2 cut(s) 248, 375
BstMBI GATC 5 cut(s) 110, 177, 227, 307, 359
BstMWI GCNNNNNNNGC 2 cut(s) 54, 94
BstX2I RGATCY 1 cut(s) 227
BstYI RGATCY 1 cut(s) 227
BsuRI GGCC 1 cut(s) 207
BtgI CCRYGG 1 cut(s) 145
BtsIMutI CAGTG 1 cut(s) 46
Cac8I GCNNGC 1 cut(s) 209
Cfr13I GGNCC 1 cut(s) 205
Csp6I GTAC 1 cut(s) 37
CviJI RGCY 7 cut(s) 57, 77, 97, 207, 352, 425, 466
CviKI_1 RGCY 7 cut(s) 57, 77, 97, 207, 352, 425, 466
CviQI GTAC 1 cut(s) 37
DdeI CTNAG 3 cut(s) 93, 98, 426
DpnI GATC 5 cut(s) 112, 179, 229, 309, 361
DpnII GATC 5 cut(s) 110, 177, 227, 307, 359
Eco31I GGTCTC 1 cut(s) 248
EcoRI GAATTC 1 cut(s) 194
FaiI YATR 3 cut(s) 46, 123, 165
FalI AAGNNNNNCTT 4 cut(s) 327, 359, 450, 482
FaqI GGGAC 1 cut(s) 214
FspBI CTAG 2 cut(s) 105, 447
HaeIII GGCC 1 cut(s) 207
HapII CCGG 1 cut(s) 138
HindIII AAGCTT 1 cut(s) 55
HinfI GANTC 7 cut(s) 117, 128, 134, 277, 291, 302, 368
HpaII CCGG 1 cut(s) 138
HphI GGTGA 4 cut(s) 10, 22, 83, 451
Hpy188I TCNGA 2 cut(s) 133, 307
Hpy188III TCNNGA 3 cut(s) 114, 199, 311
Hpy99I CGWCG 2 cut(s) 26, 499
HpyAV CCTTC 3 cut(s) 99, 182, 228
HpyCH4III ACNGT 2 cut(s) 41, 149
HpyCH4IV ACGT 1 cut(s) 497
HpyCH4V TGCA 2 cut(s) 4, 319
HpyF10VI GCNNNNNNNGC 2 cut(s) 54, 94
HpyF3I CTNAG 3 cut(s) 93, 98, 426
HpySE526I ACGT 1 cut(s) 497
Kzo9I GATC 5 cut(s) 110, 177, 227, 307, 359
LpnPI CCDG 4 cut(s) 151, 221, 359, 457
LweI GCATC 1 cut(s) 75
MaeI CTAG 2 cut(s) 105, 447
MaeII ACGT 1 cut(s) 497
MaeIII GTNAC 1 cut(s) 16
MalI GATC 5 cut(s) 112, 179, 229, 309, 361
MboI GATC 5 cut(s) 110, 177, 227, 307, 359
MflI RGATCY 1 cut(s) 227
MluCI AATT 2 cut(s) 194, 249
MlyI GAGTC 2 cut(s) 137, 377
MmeI TCCRAC 2 cut(s) 111, 305
MnlI CCTC 3 cut(s) 393, 421, 435
MspI CCGG 1 cut(s) 138
MwoI GCNNNNNNNGC 2 cut(s) 54, 94
NdeII GATC 5 cut(s) 110, 177, 227, 307, 359
NlaIV GGNNCC 1 cut(s) 229
NmuCI GTSAC 1 cut(s) 16
PcsI WCGNNNNNNNCGW 1 cut(s) 491
PfeI GAWTC 5 cut(s) 117, 134, 277, 291, 302
PleI GAGTC 2 cut(s) 136, 376
PpsI GAGTC 2 cut(s) 136, 376
PspN4I GGNNCC 1 cut(s) 229
PspPI GGNCC 1 cut(s) 205
PsuI RGATCY 1 cut(s) 227
RsaI GTAC 1 cut(s) 38
RsaNI GTAC 1 cut(s) 37
Sau3AI GATC 5 cut(s) 110, 177, 227, 307, 359
Sau96I GGNCC 1 cut(s) 205
SchI GAGTC 2 cut(s) 137, 377
SetI ASST 6 cut(s) 59, 99, 220, 354, 468, 500
SfaNI GCATC 1 cut(s) 75
Sse9I AATT 2 cut(s) 194, 249
SsiI CCGC 2 cut(s) 69, 431
SspMI CTAG 2 cut(s) 105, 447
TaaI ACNGT 2 cut(s) 41, 149
TaiI ACGT 1 cut(s) 500
TaqI TCGA 3 cut(s) 113, 324, 462
TasI AATT 2 cut(s) 194, 249
TatI WGTACW 1 cut(s) 36
TfiI GAWTC 5 cut(s) 117, 134, 277, 291, 302
TscAI CASTG 1 cut(s) 46
TseFI GTSAC 1 cut(s) 16
Tsp45I GTSAC 1 cut(s) 16
TspDTI ATGAA 1 cut(s) 407
TspRI CASTG 1 cut(s) 46
XapI RAATTY 1 cut(s) 194
XcmI CCANNNNNNNNNTGG 1 cut(s) 221
XspI CTAG 2 cut(s) 105, 447
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.