Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000003

Orthogroup ID

OG0010596

Physical Location & Seq

Genomic Coordinates Reverse (-)

47656895 .. 47660506

Gene Structure 3612 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_3G00253570.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 300 bp

ATGGAAGACATTCTTTTGAAAATGAATAGGATTTTAAGGCCACAAGGCAGTATAATTTTCAGGGAAGATGTGGATATGGTTGTGAAGGCCAAGGCGCTCTTATATGCAATACAATATGATGCTAGAATTGTAGACCATGAAGAGGCTTATAGGCTCGCTTTATTAAGTGAGCATCGATGTATAATGAGTGGTCTATACTTATGTACCACCATGGCACCCTCACAACCTCTTATCCGTCCGCTCAATGGCAATGGAGGGGTATTTAATGGTCATTTTGGCTTAAATAATGACAATCATTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005794 GO:0005802 GO:0008150 GO:0008152 GO:0008168 GO:0008757 GO:0012505 GO:0016740 GO:0016741 GO:0031410 GO:0031982 GO:0031984 GO:0032259 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044431 GO:0044444 GO:0044446 GO:0044464 GO:0097708 GO:0098791

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Methyltransf_29

Protein Analysis

99

Amino Acids

11.23

Weight (kDa)

6.39

Isoelectric Point (pI)

42.05

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Methyltransf_29	PF03141	1 - 50	6.7e-09	Putative S-adenosyl-L-methionine-dependent methyltransferase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010596)

Species	Orthologous Gene IDs
malus_domestica	MD06G1039600.v1.1 MD13G1215200.v1.1
prunus_persica	Prupe.5G045100_v2.0.a1
pyrus_communis	pycom05g00430 pycom07g24350 pycom15g02370 pycom16g23870
rosa_chinensis	RchiOBHm_Chr4g0393521
rosa_laevigata	RLG00000006414 RLG00000007546 RLG00000009741 RLG00000012464
rosa_multiflora	Rmu_co8388373.1_g000001 Rmu_sc0004469.1_g000016 Rmu_sc0004884.1_g000002 Rmu_sc0006171.1_g000002
rosa_roxburghii	Rroxscaffold_2G00086270 Rroxscaffold_3G00253570
rosa_samantha	Rh4BG043800 Rh5DG486700 Rh6CG274800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	214
AccBSI	CCGCTC	1 cut(s)	241
AccI	GTMKAC	1 cut(s)	132
AciI	CCGC	1 cut(s)	239
AfaI	GTAC	1 cut(s)	205
AfiI	CCNNNNNNNGG	2 cut(s)	142, 245
AgsI	TTSAA	1 cut(s)	19
AoxI	GGCC	2 cut(s)	38, 87
Asp700I	GAANNNNTTC	1 cut(s)	9
AspLEI	GCGC	1 cut(s)	97
BaeI	ACNNNNGTAYC	2 cut(s)	187, 220
BanI	GGYRCC	1 cut(s)	214
BbsI	GAAGAC	1 cut(s)	12
BfaI	CTAG	1 cut(s)	123
BfoI	RGCGCY	1 cut(s)	98
BmiI	GGNNCC	1 cut(s)	216
BmsI	GCATC	2 cut(s)	109, 181
BpiI	GAAGAC	1 cut(s)	12
Bsa29I	ATCGAT	1 cut(s)	175
BsaJI	CCNNGG	2 cut(s)	90, 210
Bsc4I	CCNNNNNNNGG	2 cut(s)	142, 245
Bse3DI	GCAATG	1 cut(s)	256
BseCI	ATCGAT	1 cut(s)	175
BseDI	CCNNGG	2 cut(s)	90, 210
BseLI	CCNNNNNNNGG	2 cut(s)	142, 245
BseMI	GCAATG	1 cut(s)	256
BshFI	GGCC	2 cut(s)	40, 89
BshNI	GGYRCC	1 cut(s)	214
BshVI	ATCGAT	1 cut(s)	175
BslI	CCNNNNNNNGG	2 cut(s)	142, 245
BsnI	GGCC	2 cut(s)	40, 89
Bsp19I	CCATGG	1 cut(s)	210
BspACI	CCGC	1 cut(s)	239
BspANI	GGCC	2 cut(s)	40, 89
BspDI	ATCGAT	1 cut(s)	175
BspLI	GGNNCC	1 cut(s)	216
BspT107I	GGYRCC	1 cut(s)	214
BsrBI	CCGCTC	1 cut(s)	241
BsrDI	GCAATG	1 cut(s)	256
BssECI	CCNNGG	2 cut(s)	90, 210
BssT1I	CCWWGG	2 cut(s)	90, 210
Bst6I	CTCTTC	1 cut(s)	135
BstC8I	GCNNGC	1 cut(s)	156
BstDSI	CCRYGG	1 cut(s)	210
BstH2I	RGCGCY	1 cut(s)	98
BstHHI	GCGC	1 cut(s)	97
BstV2I	GAAGAC	1 cut(s)	12
Bsu15I	ATCGAT	1 cut(s)	175
BsuRI	GGCC	2 cut(s)	40, 89
BsuTUI	ATCGAT	1 cut(s)	175
BtgI	CCRYGG	1 cut(s)	210
Cac8I	GCNNGC	1 cut(s)	156
CfoI	GCGC	1 cut(s)	97
ClaI	ATCGAT	1 cut(s)	175
Csp6I	GTAC	1 cut(s)	204
CviAII	CATG	2 cut(s)	137, 211
CviJI	RGCY	5 cut(s)	40, 89, 146, 154, 279
CviKI_1	RGCY	5 cut(s)	40, 89, 146, 154, 279
CviQI	GTAC	1 cut(s)	204
Eam1104I	CTCTTC	1 cut(s)	135
EarI	CTCTTC	1 cut(s)	135
Eco130I	CCWWGG	2 cut(s)	90, 210
EcoT14I	CCWWGG	2 cut(s)	90, 210
ErhI	CCWWGG	2 cut(s)	90, 210
FaeI	CATG	2 cut(s)	140, 214
FalI	AAGNNNNNCTT	3 cut(s)	29, 83, 115
FatI	CATG	2 cut(s)	136, 210
FblI	GTMKAC	1 cut(s)	132
FspBI	CTAG	1 cut(s)	123
GlaI	GCGC	1 cut(s)	96
HaeII	RGCGCY	1 cut(s)	98
HaeIII	GGCC	2 cut(s)	40, 89
HhaI	GCGC	1 cut(s)	97
Hin1II	CATG	2 cut(s)	140, 214
Hin6I	GCGC	1 cut(s)	95
HinP1I	GCGC	1 cut(s)	95
Hpy166II	GTNNAC	1 cut(s)	133
Hpy8I	GTNNAC	1 cut(s)	133
HpyAV	CCTTC	1 cut(s)	79
HpyCH4V	TGCA	1 cut(s)	107
Hsp92II	CATG	2 cut(s)	140, 214
HspAI	GCGC	1 cut(s)	95
LpnPI	CCDG	1 cut(s)	46
LweI	GCATC	2 cut(s)	109, 181
MaeI	CTAG	1 cut(s)	123
MbiI	CCGCTC	1 cut(s)	241
MboII	GAAGA	3 cut(s)	17, 77, 152
MluCI	AATT	2 cut(s)	54, 126
MnlI	CCTC	4 cut(s)	136, 229, 237, 248
MroXI	GAANNNNTTC	1 cut(s)	9
MseI	TTAA	4 cut(s)	35, 164, 264, 281
NcoI	CCATGG	1 cut(s)	210
NlaIII	CATG	2 cut(s)	140, 214
NlaIV	GGNNCC	1 cut(s)	216
PdmI	GAANNNNTTC	1 cut(s)	9
PspN4I	GGNNCC	1 cut(s)	216
RsaI	GTAC	1 cut(s)	205
RsaNI	GTAC	1 cut(s)	204
SaqAI	TTAA	4 cut(s)	35, 164, 264, 281
SetI	ASST	1 cut(s)	229
SfaNI	GCATC	2 cut(s)	109, 181
SgeI	CNNG	7 cut(s)	56, 73, 103, 135, 149, 167, 223
Sse9I	AATT	2 cut(s)	54, 126
SsiI	CCGC	1 cut(s)	239
SspMI	CTAG	1 cut(s)	123
StyI	CCWWGG	2 cut(s)	90, 210
TaqI	TCGA	1 cut(s)	175
TasI	AATT	2 cut(s)	54, 126
Tru1I	TTAA	4 cut(s)	35, 164, 264, 281
Tru9I	TTAA	4 cut(s)	35, 164, 264, 281
TspDTI	ATGAA	2 cut(s)	38, 153
TspGWI	ACGGA	1 cut(s)	224
XmiI	GTMKAC	1 cut(s)	132
XmnI	GAANNNNTTC	1 cut(s)	9
XspI	CTAG	1 cut(s)	123

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.